Mutagenetix > Incidental Mutations

Incidental Mutation 'R0288:Dsc2'

24757

Institutional Source

Beutler Lab

Gene Symbol

Dsc2

Ensembl Gene

ENSMUSG00000024331

Gene Name

desmocollin 2

Synonyms

Dsc2b, Dsc2a

MMRRC Submission

038507-MU

Accession Numbers

Genbank: NM_013505; MGI: 103221

Is this an essential gene?

Non essential (E-score: 0.000) question?

Stock #

R0288 (G1)

Quality Score

225

Status

Validated

Chromosome

Chromosomal Location

20030633-20059554 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

T to C at 20033120 bp

Zygosity

Heterozygous

Amino Acid Change

Aspartic acid to Glycine at position 818 (D818G)

Ref Sequence

ENSEMBL: ENSMUSP00000074702 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000039247] [ENSMUST00000075214] [ENSMUST00000128464]

Predicted Effect

probably damaging
Transcript: ENSMUST00000039247
AA Change: D818G

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)

SMART Domains

Protein: ENSMUSP00000042905
Gene: ENSMUSG00000024331
AA Change: D818G

Domain	Start	End	E-Value	Type
Cadherin_pro	31	113	2.82e-37	SMART
CA	156	241	4.66e-11	SMART
CA	265	353	1.87e-24	SMART
low complexity region	358	372	N/A	INTRINSIC
CA	376	470	1.27e-12	SMART
CA	493	575	4.14e-17	SMART
CA	594	676	1.49e-1	SMART
transmembrane domain	696	718	N/A	INTRINSIC

Predicted Effect

probably damaging
Transcript: ENSMUST00000075214
AA Change: D818G

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)

SMART Domains

Protein: ENSMUSP00000074702
Gene: ENSMUSG00000024331
AA Change: D818G

Domain	Start	End	E-Value	Type
signal peptide	1	28	N/A	INTRINSIC
Cadherin_pro	31	113	2.82e-37	SMART
CA	156	241	4.66e-11	SMART
CA	265	353	1.87e-24	SMART
low complexity region	358	372	N/A	INTRINSIC
CA	376	470	1.27e-12	SMART
CA	493	575	4.14e-17	SMART
CA	594	676	1.49e-1	SMART
transmembrane domain	696	718	N/A	INTRINSIC
Pfam:Cadherin_C	730	901	3.7e-9	PFAM

Predicted Effect

probably benign
Transcript: ENSMUST00000128464

SMART Domains

Protein: ENSMUSP00000123010
Gene: ENSMUSG00000024331

Domain	Start	End	E-Value	Type
Cadherin_pro	31	113	2.82e-37	SMART

Predicted Effect

unknown
Transcript: ENSMUST00000155407
AA Change: D217G

SMART Domains

Protein: ENSMUSP00000116063
Gene: ENSMUSG00000024331
AA Change: D217G

Domain	Start	End	E-Value	Type
SCOP:d1l3wa5	2	71	2e-3	SMART
Blast:CA	2	76	2e-47	BLAST
transmembrane domain	96	118	N/A	INTRINSIC

Meta Mutation Damage Score

0.2799

Coding Region Coverage

1x: 98.8%
3x: 97.8%
10x: 95.1%
20x: 89.7%

Validation Efficiency

98% (62/63)

MGI Phenotype

FUNCTION: This gene encodes a member of the desmocollin protein subfamily. Desmocollins are cadherin-like transmembrane glycoproteins that are major components of the desmosome. Desmosomes are cell-cell junctions that help resist shearing forces and are found in high concentrations in cells subject to mechanical stress. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Dec 2015]

Allele List at MGI

All alleles(2) : Targeted, other(2)

Other mutations in this stock

Total: 60 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Adgrg3	A	G	8: 95,039,940	E413G	possibly damaging	Het
Amigo2	G	T	15: 97,245,679	N287K	probably damaging	Het
Ankle2	T	A	5: 110,236,390	I260K	probably damaging	Het
Apob	C	T	12: 7,990,779	R635*	probably null	Het
Camkv	A	G	9: 107,946,356	Y153C	probably damaging	Het
Capn9	A	G	8: 124,600,491		probably benign	Het
Ces2c	A	G	8: 104,849,744	I130V	probably benign	Het
Cfap44	T	A	16: 44,415,894		probably benign	Het
Cfhr3	A	G	1: 139,597,687		noncoding transcript	Het
Chmp1a	G	T	8: 123,208,006	D70E	probably damaging	Het
Coil	G	A	11: 88,981,868	G352R	probably damaging	Het
Colq	T	C	14: 31,543,992	E188G	possibly damaging	Het
Cyfip2	A	G	11: 46,253,972	F685S	possibly damaging	Het
Cyp4f39	A	G	17: 32,492,436	N519S	probably benign	Het
Dennd1c	A	T	17: 57,076,870		probably null	Het
Dnah9	A	T	11: 66,025,134		probably null	Het
Dnmbp	T	C	19: 43,902,459	T290A	possibly damaging	Het
Gnptab	G	A	10: 88,433,105	V557I	probably benign	Het
Hdac4	A	T	1: 91,971,006	H675Q	probably damaging	Het
Kcnk3	T	C	5: 30,588,420	M35T	probably benign	Het
Kif1b	A	T	4: 149,199,338	I1290N	probably damaging	Het
Klhl14	G	A	18: 21,565,563	R398W	probably damaging	Het
Marveld1	T	C	19: 42,147,826	F60L	probably damaging	Het
Miox	C	T	15: 89,336,274	L189F	possibly damaging	Het
Ncoa6	TGC	TGCGC	2: 155,408,291		probably null	Het
Ndst3	A	T	3: 123,672,194	V43D	probably benign	Het
Nhsl1	A	G	10: 18,524,046	D306G	probably damaging	Het
Nlrp2	A	G	7: 5,328,545	V284A	probably benign	Het
Pcdhb15	T	C	18: 37,475,398	V561A	probably damaging	Het
Pdcl2	T	C	5: 76,312,497	I177V	possibly damaging	Het
Pkd1l3	G	A	8: 109,646,499		probably null	Het
Pla2g6	A	C	15: 79,286,906		probably benign	Het
Plekhj1	A	T	10: 80,796,610	I122N	probably damaging	Het
Pmel	T	C	10: 128,714,306	I70T	probably benign	Het
Psip1	T	C	4: 83,464,959	D273G	probably damaging	Het
Rictor	A	G	15: 6,786,540	I1098V	probably benign	Het
Rif1	T	C	2: 52,110,013	S1160P	probably damaging	Het
Rsbn1l	T	C	5: 20,920,040	I255V	probably damaging	Het
Slc15a5	A	G	6: 138,017,916		probably benign	Het
Slc29a1	G	A	17: 45,589,804	R111W	probably damaging	Het
Slc36a1	G	A	11: 55,219,087	A74T	probably damaging	Het
Slc5a7	A	T	17: 54,293,018	Y122*	probably null	Het
Slc6a3	G	T	13: 73,560,928	G324W	probably damaging	Het
Sltm	T	C	9: 70,579,351	S433P	probably damaging	Het
Spta1	T	C	1: 174,243,179	S2190P	probably damaging	Het
Sry	A	T	Y: 2,662,818	F281I	unknown	Het
Stk32a	T	A	18: 43,304,995		probably null	Het
Sytl2	T	C	7: 90,403,020		probably benign	Het
Tbl3	G	A	17: 24,701,807	H612Y	probably damaging	Het
Tmem144	G	A	3: 79,839,273		probably benign	Het
Top2a	A	G	11: 99,016,423		probably benign	Het
Usp9y	A	T	Y: 1,333,606		probably benign	Het
Vldlr	G	A	19: 27,240,651		probably benign	Het
Vmn1r28	G	A	6: 58,265,717	A182T	probably benign	Het
Vmn2r28	A	G	7: 5,488,021	L409P	probably damaging	Het
Vps13c	T	C	9: 67,927,366	V1659A	probably damaging	Het
Wdr17	C	T	8: 54,693,096	A90T	possibly damaging	Het
Zfp280d	A	T	9: 72,331,339	K646*	probably null	Het
Zfp36	A	G	7: 28,378,241	S81P	probably benign	Het
Zfp618	A	T	4: 63,132,934	T651S	possibly damaging	Het

Other mutations in Dsc2

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00802:Dsc2	APN	18	20041797	missense	probably benign	0.01
IGL00826:Dsc2	APN	18	20035315	missense	probably damaging	1.00
IGL00852:Dsc2	APN	18	20034683	missense	probably benign	0.01
IGL01082:Dsc2	APN	18	20043792	missense	probably damaging	1.00
IGL01328:Dsc2	APN	18	20048286	missense	probably damaging	0.98
IGL01338:Dsc2	APN	18	20047157	missense	probably benign	0.19
IGL01727:Dsc2	APN	18	20038200	missense	probably benign	0.01
IGL01766:Dsc2	APN	18	20046342	missense	possibly damaging	0.56
IGL02228:Dsc2	APN	18	20043733	missense	probably damaging	0.99
IGL02560:Dsc2	APN	18	20045539	missense	probably damaging	1.00
IGL02794:Dsc2	APN	18	20041731	missense	probably damaging	1.00
3-1:Dsc2	UTSW	18	20047079	missense	possibly damaging	0.60
PIT4305001:Dsc2	UTSW	18	20046243	missense	probably damaging	0.96
PIT4431001:Dsc2	UTSW	18	20046277	nonsense	probably null
R0542:Dsc2	UTSW	18	20051226	missense	probably damaging	0.99
R0562:Dsc2	UTSW	18	20041537	missense	probably damaging	0.99
R0697:Dsc2	UTSW	18	20041452	missense	probably damaging	0.99
R0940:Dsc2	UTSW	18	20050059	missense	probably damaging	0.97
R1081:Dsc2	UTSW	18	20033295	missense	probably damaging	0.96
R1140:Dsc2	UTSW	18	20032212	missense	probably damaging	1.00
R1515:Dsc2	UTSW	18	20034701	missense	probably damaging	0.99
R1515:Dsc2	UTSW	18	20045565	missense	probably benign	0.40
R1558:Dsc2	UTSW	18	20050151	missense	probably damaging	0.99
R1654:Dsc2	UTSW	18	20046246	missense	probably benign	0.01
R2061:Dsc2	UTSW	18	20032399	missense	possibly damaging	0.79
R2089:Dsc2	UTSW	18	20033294	missense	possibly damaging	0.65
R2091:Dsc2	UTSW	18	20033294	missense	possibly damaging	0.65
R2091:Dsc2	UTSW	18	20033294	missense	possibly damaging	0.65
R2172:Dsc2	UTSW	18	20045502	missense	probably damaging	1.00
R2247:Dsc2	UTSW	18	20035312	missense	probably damaging	1.00
R2472:Dsc2	UTSW	18	20045469	missense	probably benign	0.00
R2927:Dsc2	UTSW	18	20045501	missense	probably damaging	1.00
R3611:Dsc2	UTSW	18	20032351	missense	probably damaging	0.99
R3961:Dsc2	UTSW	18	20051227	missense	probably damaging	0.98
R3963:Dsc2	UTSW	18	20051227	missense	probably damaging	0.98
R4353:Dsc2	UTSW	18	20050068	missense	probably damaging	1.00
R4362:Dsc2	UTSW	18	20050157	missense	probably damaging	1.00
R4612:Dsc2	UTSW	18	20041819	missense	probably damaging	1.00
R4613:Dsc2	UTSW	18	20041819	missense	probably damaging	1.00
R4752:Dsc2	UTSW	18	20038222	missense	probably damaging	1.00
R4946:Dsc2	UTSW	18	20050157	missense	probably damaging	1.00
R5056:Dsc2	UTSW	18	20050142	missense	probably damaging	1.00
R5267:Dsc2	UTSW	18	20034583	critical splice donor site	probably null
R5445:Dsc2	UTSW	18	20035303	missense	possibly damaging	0.76
R5507:Dsc2	UTSW	18	20046279	missense	probably damaging	0.96
R5575:Dsc2	UTSW	18	20035390	missense	probably damaging	1.00
R5781:Dsc2	UTSW	18	20032510	missense	probably benign	0.00
R6102:Dsc2	UTSW	18	20047108	missense	probably benign	0.01
R6129:Dsc2	UTSW	18	20045430	missense	possibly damaging	0.95
R6362:Dsc2	UTSW	18	20035463	nonsense	probably null
R6433:Dsc2	UTSW	18	20051175	critical splice donor site	probably null
R6513:Dsc2	UTSW	18	20046238	missense	probably benign
R6615:Dsc2	UTSW	18	20032519	missense	possibly damaging	0.88
R6619:Dsc2	UTSW	18	20032278	missense	probably benign	0.22
R6665:Dsc2	UTSW	18	20050148	missense	probably damaging	1.00
R6961:Dsc2	UTSW	18	20038222	missense	probably damaging	1.00
R7179:Dsc2	UTSW	18	20035275	critical splice donor site	probably null
R7275:Dsc2	UTSW	18	20051179	nonsense	probably null
R7352:Dsc2	UTSW	18	20035335	missense	probably benign	0.39
R7386:Dsc2	UTSW	18	20041926	missense	possibly damaging	0.84
R7496:Dsc2	UTSW	18	20035394	nonsense	probably null
R7510:Dsc2	UTSW	18	20032274	missense	possibly damaging	0.78
R7580:Dsc2	UTSW	18	20050073	missense	probably damaging	1.00
R7718:Dsc2	UTSW	18	20041778	missense	probably damaging	0.98
R7733:Dsc2	UTSW	18	20048315	missense	probably benign	0.00
R7733:Dsc2	UTSW	18	20048316	missense	probably benign	0.16
R7818:Dsc2	UTSW	18	20050132	missense	probably damaging	1.00
R7852:Dsc2	UTSW	18	20046285	missense	possibly damaging	0.67
R7935:Dsc2	UTSW	18	20046285	missense	possibly damaging	0.67
R7998:Dsc2	UTSW	18	20034663	missense	possibly damaging	0.87
R8029:Dsc2	UTSW	18	20032274	missense	possibly damaging	0.78
R8030:Dsc2	UTSW	18	20032274	missense	possibly damaging	0.78
R8031:Dsc2	UTSW	18	20032274	missense	possibly damaging	0.78
R8032:Dsc2	UTSW	18	20032274	missense	possibly damaging	0.78
R8059:Dsc2	UTSW	18	20032274	missense	possibly damaging	0.78
R8060:Dsc2	UTSW	18	20032274	missense	possibly damaging	0.78
R8061:Dsc2	UTSW	18	20032274	missense	possibly damaging	0.78
R8062:Dsc2	UTSW	18	20032274	missense	possibly damaging	0.78
R8063:Dsc2	UTSW	18	20032274	missense	possibly damaging	0.78
Z1088:Dsc2	UTSW	18	20046304	missense	probably damaging	0.98
Z1176:Dsc2	UTSW	18	20035299	missense	probably damaging	1.00

Predicted Primers

PCR Primer
(F):5'- TGTCACTGAGCACCCAAGTACTCC -3'
(R):5'- TTCTGGGCAGACAGCTTTCACCAC -3'

Sequencing Primer
(F):5'- GAACCCAAATTGATGTGAGTTCC -3'
(R):5'- AAAGGAGGGCAGCAGACTTT -3'

Posted On

2013-04-16