Incidental Mutation 'R2382:Aarsd1'
ID247576
Institutional Source Beutler Lab
Gene Symbol Aarsd1
Ensembl Gene ENSMUSG00000075528
Gene Namealanyl-tRNA synthetase domain containing 1
Synonyms2310044P18Rik
MMRRC Submission 040357-MU
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.363) question?
Stock #R2382 (G1)
Quality Score225
Status Not validated
Chromosome11
Chromosomal Location101406839-101417615 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 101414078 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Phenylalanine at position 64 (I64F)
Ref Sequence ENSEMBL: ENSMUSP00000067912 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000070395] [ENSMUST00000103102] [ENSMUST00000107252] [ENSMUST00000107257] [ENSMUST00000107259]
Predicted Effect probably damaging
Transcript: ENSMUST00000070395
AA Change: I64F

PolyPhen 2 Score 0.991 (Sensitivity: 0.71; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000067912
Gene: ENSMUSG00000075528
AA Change: I64F

DomainStartEndE-ValueType
Pfam:tRNA-synt_2c 8 101 1.5e-8 PFAM
tRNA_SAD 196 239 1.43e-6 SMART
low complexity region 276 293 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000103102
SMART Domains Protein: ENSMUSP00000099391
Gene: ENSMUSG00000097487

DomainStartEndE-ValueType
Pfam:CS 6 80 7.3e-9 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000107252
SMART Domains Protein: ENSMUSP00000102873
Gene: ENSMUSG00000097487

DomainStartEndE-ValueType
Pfam:CS 6 80 9.6e-9 PFAM
low complexity region 141 149 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000107257
AA Change: I177F

PolyPhen 2 Score 0.985 (Sensitivity: 0.74; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000102878
Gene: ENSMUSG00000097239
AA Change: I177F

DomainStartEndE-ValueType
Pfam:tRNA-synt_2c 91 214 1.4e-8 PFAM
tRNA_SAD 309 352 1.43e-6 SMART
low complexity region 389 406 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000107259
AA Change: I195F

PolyPhen 2 Score 0.985 (Sensitivity: 0.74; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000102880
Gene: ENSMUSG00000097239
AA Change: I195F

DomainStartEndE-ValueType
Pfam:tRNA-synt_2c 109 232 3.4e-9 PFAM
tRNA_SAD 327 370 1.43e-6 SMART
low complexity region 407 424 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000125472
Predicted Effect noncoding transcript
Transcript: ENSMUST00000133240
Predicted Effect noncoding transcript
Transcript: ENSMUST00000140123
Predicted Effect noncoding transcript
Transcript: ENSMUST00000189049
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.5%
  • 10x: 96.9%
  • 20x: 93.8%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 39 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2700049A03Rik G T 12: 71,164,546 E685* probably null Het
2700049A03Rik A T 12: 71,164,547 E685V possibly damaging Het
Agrn T A 4: 156,176,516 D574V probably damaging Het
Atg4b T C 1: 93,784,842 C16R probably damaging Het
Ccdc141 A T 2: 77,011,542 L1515Q probably damaging Het
Ccdc141 A T 2: 77,074,998 V368E probably benign Het
Clk1 A T 1: 58,421,289 S61T probably benign Het
Dhx38 A T 8: 109,556,140 D631E probably damaging Het
Dner C G 1: 84,370,823 E719Q probably damaging Het
E030025P04Rik G A 11: 109,144,054 Q3* probably null Het
Eif4g2 T A 7: 111,075,046 T613S probably benign Het
Fn1 C G 1: 71,648,119 G193A probably damaging Het
Gls2 A G 10: 128,203,842 E286G probably damaging Het
Gm21286 A G 4: 60,838,284 noncoding transcript Het
Gm6614 G A 6: 141,990,480 S293F probably benign Het
Gm813 T C 16: 58,615,876 probably null Het
Hoxa13 A T 6: 52,259,145 V304D probably damaging Het
Hpse2 A T 19: 42,931,622 M346K probably benign Het
Igkv1-99 A T 6: 68,542,497 probably benign Het
Kcnq2 A G 2: 181,112,107 Y237H probably damaging Het
Kmt2a T A 9: 44,820,910 probably benign Het
Kntc1 A G 5: 123,760,348 D180G probably damaging Het
Macf1 G A 4: 123,374,832 T4682M probably damaging Het
Mfsd6 T A 1: 52,708,410 H432L probably benign Het
Mgat5b T A 11: 116,919,496 D7E probably damaging Het
Msh6 G A 17: 87,984,731 V305I probably benign Het
Notch1 A T 2: 26,473,781 H880Q probably benign Het
Olfr117 A C 17: 37,659,931 V134G probably benign Het
Olfr1353 G A 10: 78,970,156 C169Y probably damaging Het
Olfr57 A T 10: 79,035,134 I113F possibly damaging Het
Pmepa1 G A 2: 173,228,133 R210W probably damaging Het
Pnliprp2 A G 19: 58,768,630 N308S probably benign Het
Ppwd1 T C 13: 104,207,113 T595A probably damaging Het
Prdm13 T C 4: 21,678,277 T738A possibly damaging Het
Rab11fip3 T A 17: 25,990,867 K1062* probably null Het
Reep3 A T 10: 67,096,790 V11E possibly damaging Het
Slco3a1 T C 7: 74,346,776 D294G probably benign Het
Sycp2 A G 2: 178,378,018 probably null Het
Zfp292 A G 4: 34,806,426 V2206A possibly damaging Het
Other mutations in Aarsd1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01810:Aarsd1 APN 11 101417359 nonsense probably null
R0462:Aarsd1 UTSW 11 101414091 missense probably damaging 1.00
R1885:Aarsd1 UTSW 11 101411401 missense probably benign 0.33
R1886:Aarsd1 UTSW 11 101411401 missense probably benign 0.33
R1909:Aarsd1 UTSW 11 101410231 intron probably null
R3820:Aarsd1 UTSW 11 101411145 missense probably damaging 1.00
R3821:Aarsd1 UTSW 11 101411145 missense probably damaging 1.00
R3822:Aarsd1 UTSW 11 101411145 missense probably damaging 1.00
R4034:Aarsd1 UTSW 11 101411332 missense probably damaging 1.00
R4701:Aarsd1 UTSW 11 101411160 missense probably benign 0.00
R5204:Aarsd1 UTSW 11 101406926 missense probably damaging 1.00
R5327:Aarsd1 UTSW 11 101410377 missense probably benign 0.30
R5554:Aarsd1 UTSW 11 101413981 missense probably benign 0.01
R7342:Aarsd1 UTSW 11 101417192 missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- ACTGTGACTCGGCTATTCACG -3'
(R):5'- CTGTTCTGCCCTGAAAACACC -3'

Sequencing Primer
(F):5'- GCTATTCACGGCCCGTC -3'
(R):5'- TGTTCTGCCCTGAAAACACCAAAAG -3'
Posted On2014-11-11