Incidental Mutation 'R2382:E030025P04Rik'
ID247577
Institutional Source Beutler Lab
Gene Symbol E030025P04Rik
Ensembl Gene ENSMUSG00000078605
Gene NameRIKEN cDNA E030025P04 gene
Synonyms
MMRRC Submission 040357-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.071) question?
Stock #R2382 (G1)
Quality Score206
Status Not validated
Chromosome11
Chromosomal Location109139291-109144369 bp(-) (GRCm38)
Type of Mutationnonsense
DNA Base Change (assembly) G to A at 109144054 bp
ZygosityHeterozygous
Amino Acid Change Glutamine to Stop codon at position 3 (Q3*)
Ref Sequence ENSEMBL: ENSMUSP00000102321 (fasta)
Predicted Effect probably null
Transcript: ENSMUST00000106710
AA Change: Q3*
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.5%
  • 10x: 96.9%
  • 20x: 93.8%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 39 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2700049A03Rik G T 12: 71,164,546 E685* probably null Het
2700049A03Rik A T 12: 71,164,547 E685V possibly damaging Het
Aarsd1 T A 11: 101,414,078 I64F probably damaging Het
Agrn T A 4: 156,176,516 D574V probably damaging Het
Atg4b T C 1: 93,784,842 C16R probably damaging Het
Ccdc141 A T 2: 77,011,542 L1515Q probably damaging Het
Ccdc141 A T 2: 77,074,998 V368E probably benign Het
Clk1 A T 1: 58,421,289 S61T probably benign Het
Dhx38 A T 8: 109,556,140 D631E probably damaging Het
Dner C G 1: 84,370,823 E719Q probably damaging Het
Eif4g2 T A 7: 111,075,046 T613S probably benign Het
Fn1 C G 1: 71,648,119 G193A probably damaging Het
Gls2 A G 10: 128,203,842 E286G probably damaging Het
Gm21286 A G 4: 60,838,284 noncoding transcript Het
Gm6614 G A 6: 141,990,480 S293F probably benign Het
Gm813 T C 16: 58,615,876 probably null Het
Hoxa13 A T 6: 52,259,145 V304D probably damaging Het
Hpse2 A T 19: 42,931,622 M346K probably benign Het
Igkv1-99 A T 6: 68,542,497 probably benign Het
Kcnq2 A G 2: 181,112,107 Y237H probably damaging Het
Kmt2a T A 9: 44,820,910 probably benign Het
Kntc1 A G 5: 123,760,348 D180G probably damaging Het
Macf1 G A 4: 123,374,832 T4682M probably damaging Het
Mfsd6 T A 1: 52,708,410 H432L probably benign Het
Mgat5b T A 11: 116,919,496 D7E probably damaging Het
Msh6 G A 17: 87,984,731 V305I probably benign Het
Notch1 A T 2: 26,473,781 H880Q probably benign Het
Olfr117 A C 17: 37,659,931 V134G probably benign Het
Olfr1353 G A 10: 78,970,156 C169Y probably damaging Het
Olfr57 A T 10: 79,035,134 I113F possibly damaging Het
Pmepa1 G A 2: 173,228,133 R210W probably damaging Het
Pnliprp2 A G 19: 58,768,630 N308S probably benign Het
Ppwd1 T C 13: 104,207,113 T595A probably damaging Het
Prdm13 T C 4: 21,678,277 T738A possibly damaging Het
Rab11fip3 T A 17: 25,990,867 K1062* probably null Het
Reep3 A T 10: 67,096,790 V11E possibly damaging Het
Slco3a1 T C 7: 74,346,776 D294G probably benign Het
Sycp2 A G 2: 178,378,018 probably null Het
Zfp292 A G 4: 34,806,426 V2206A possibly damaging Het
Other mutations in E030025P04Rik
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01566:E030025P04Rik APN 11 109143888 missense unknown
IGL02709:E030025P04Rik APN 11 109139498 utr 3 prime probably benign
Tipper UTSW 11 109139599 missense unknown
K3955:E030025P04Rik UTSW 11 109143952 missense unknown
R1842:E030025P04Rik UTSW 11 109139570 missense unknown
R1854:E030025P04Rik UTSW 11 109143918 missense unknown
R6413:E030025P04Rik UTSW 11 109139599 missense unknown
R6870:E030025P04Rik UTSW 11 109140167 missense unknown
Predicted Primers PCR Primer
(F):5'- AACAGTCGGATCCCTTCCATC -3'
(R):5'- GGAACAGATCCCATTCTGCTG -3'

Sequencing Primer
(F):5'- CCATCCTGGTCTTGGCTGAAG -3'
(R):5'- CTGGGAACGCTCTGAGATG -3'
Posted On2014-11-11