Incidental Mutation 'R2382:Mgat5b'
ID247578
Institutional Source Beutler Lab
Gene Symbol Mgat5b
Ensembl Gene ENSMUSG00000043857
Gene Namemannoside acetylglucosaminyltransferase 5, isoenzyme B
SynonymsGnT-IX
MMRRC Submission 040357-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.083) question?
Stock #R2382 (G1)
Quality Score225
Status Not validated
Chromosome11
Chromosomal Location116918863-116986948 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 116919496 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Glutamic Acid at position 7 (D7E)
Ref Sequence ENSEMBL: ENSMUSP00000099316 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000103027]
Predicted Effect probably damaging
Transcript: ENSMUST00000103027
AA Change: D7E

PolyPhen 2 Score 0.987 (Sensitivity: 0.73; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000099316
Gene: ENSMUSG00000043857
AA Change: D7E

DomainStartEndE-ValueType
transmembrane domain 21 43 N/A INTRINSIC
Pfam:Glyco_transf_18 184 777 3.5e-269 PFAM
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.5%
  • 10x: 96.9%
  • 20x: 93.8%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The MGAT5B gene encodes a beta-1,6-N-acetylglucosaminyltransferase (EC 2.4.1.155) that functions in the synthesis of complex cell surface N-glycans (Kaneko et al., 2003 [PubMed 14623122]).[supplied by OMIM, Nov 2008]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit low levels of O-man-linked beta1,6-branched glycans. Mice homozygous for a different knock-out allele exhibit decreased susceptibility to cuprizone induced injury. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 39 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2700049A03Rik G T 12: 71,164,546 E685* probably null Het
2700049A03Rik A T 12: 71,164,547 E685V possibly damaging Het
Aarsd1 T A 11: 101,414,078 I64F probably damaging Het
Agrn T A 4: 156,176,516 D574V probably damaging Het
Atg4b T C 1: 93,784,842 C16R probably damaging Het
Ccdc141 A T 2: 77,011,542 L1515Q probably damaging Het
Ccdc141 A T 2: 77,074,998 V368E probably benign Het
Clk1 A T 1: 58,421,289 S61T probably benign Het
Dhx38 A T 8: 109,556,140 D631E probably damaging Het
Dner C G 1: 84,370,823 E719Q probably damaging Het
E030025P04Rik G A 11: 109,144,054 Q3* probably null Het
Eif4g2 T A 7: 111,075,046 T613S probably benign Het
Fn1 C G 1: 71,648,119 G193A probably damaging Het
Gls2 A G 10: 128,203,842 E286G probably damaging Het
Gm21286 A G 4: 60,838,284 noncoding transcript Het
Gm6614 G A 6: 141,990,480 S293F probably benign Het
Gm813 T C 16: 58,615,876 probably null Het
Hoxa13 A T 6: 52,259,145 V304D probably damaging Het
Hpse2 A T 19: 42,931,622 M346K probably benign Het
Igkv1-99 A T 6: 68,542,497 probably benign Het
Kcnq2 A G 2: 181,112,107 Y237H probably damaging Het
Kmt2a T A 9: 44,820,910 probably benign Het
Kntc1 A G 5: 123,760,348 D180G probably damaging Het
Macf1 G A 4: 123,374,832 T4682M probably damaging Het
Mfsd6 T A 1: 52,708,410 H432L probably benign Het
Msh6 G A 17: 87,984,731 V305I probably benign Het
Notch1 A T 2: 26,473,781 H880Q probably benign Het
Olfr117 A C 17: 37,659,931 V134G probably benign Het
Olfr1353 G A 10: 78,970,156 C169Y probably damaging Het
Olfr57 A T 10: 79,035,134 I113F possibly damaging Het
Pmepa1 G A 2: 173,228,133 R210W probably damaging Het
Pnliprp2 A G 19: 58,768,630 N308S probably benign Het
Ppwd1 T C 13: 104,207,113 T595A probably damaging Het
Prdm13 T C 4: 21,678,277 T738A possibly damaging Het
Rab11fip3 T A 17: 25,990,867 K1062* probably null Het
Reep3 A T 10: 67,096,790 V11E possibly damaging Het
Slco3a1 T C 7: 74,346,776 D294G probably benign Het
Sycp2 A G 2: 178,378,018 probably null Het
Zfp292 A G 4: 34,806,426 V2206A possibly damaging Het
Other mutations in Mgat5b
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00233:Mgat5b APN 11 116931662 missense probably damaging 0.99
IGL01315:Mgat5b APN 11 116923389 missense probably damaging 1.00
IGL01432:Mgat5b APN 11 116973376 missense probably benign
IGL01480:Mgat5b APN 11 116978452 missense probably benign 0.00
IGL02573:Mgat5b APN 11 116977714 missense probably benign 0.01
IGL02627:Mgat5b APN 11 116983616 missense probably damaging 1.00
IGL03053:Mgat5b APN 11 116923450 missense possibly damaging 0.94
R0149:Mgat5b UTSW 11 116985139 splice site probably benign
R1175:Mgat5b UTSW 11 116977796 missense probably damaging 1.00
R1242:Mgat5b UTSW 11 116978404 missense probably benign 0.08
R1341:Mgat5b UTSW 11 116978397 missense probably benign 0.38
R1666:Mgat5b UTSW 11 116983648 missense probably benign 0.01
R1667:Mgat5b UTSW 11 116947377 missense probably benign 0.00
R1668:Mgat5b UTSW 11 116983648 missense probably benign 0.01
R1702:Mgat5b UTSW 11 116948659 missense possibly damaging 0.73
R1828:Mgat5b UTSW 11 116977788 missense probably damaging 1.00
R2019:Mgat5b UTSW 11 116947348 missense probably benign 0.07
R2102:Mgat5b UTSW 11 116919429 start gained probably benign
R4995:Mgat5b UTSW 11 116974199 critical splice donor site probably null
R5028:Mgat5b UTSW 11 116985029 missense probably damaging 1.00
R5174:Mgat5b UTSW 11 116977715 missense probably benign 0.01
R5403:Mgat5b UTSW 11 116948657 missense probably benign 0.35
R5643:Mgat5b UTSW 11 116973400 missense probably damaging 0.99
R5644:Mgat5b UTSW 11 116973400 missense probably damaging 0.99
R7116:Mgat5b UTSW 11 116944959 missense possibly damaging 0.93
R7238:Mgat5b UTSW 11 116984983 missense probably benign 0.09
R7284:Mgat5b UTSW 11 116944920 missense probably damaging 0.96
R7440:Mgat5b UTSW 11 116968445 nonsense probably null
R7721:Mgat5b UTSW 11 116966801 missense
R8179:Mgat5b UTSW 11 116931728 missense probably benign 0.01
R8229:Mgat5b UTSW 11 116947387 missense probably benign 0.11
Predicted Primers PCR Primer
(F):5'- CTTCCCCAAAATGTGAATCGGG -3'
(R):5'- TAGACTCGCGAACCTCCTTTG -3'

Sequencing Primer
(F):5'- AAGCTCTCGCCGAACCC -3'
(R):5'- TTTGCCACCCGAACTCG -3'
Posted On2014-11-11