Incidental Mutation 'R2382:Ppwd1'
ID247581
Institutional Source Beutler Lab
Gene Symbol Ppwd1
Ensembl Gene ENSMUSG00000021713
Gene Namepeptidylprolyl isomerase domain and WD repeat containing 1
Synonyms4632422M10Rik, A330090G21Rik
MMRRC Submission 040357-MU
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.959) question?
Stock #R2382 (G1)
Quality Score225
Status Not validated
Chromosome13
Chromosomal Location104205124-104228843 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 104207113 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Alanine at position 595 (T595A)
Ref Sequence ENSEMBL: ENSMUSP00000022226 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000022225] [ENSMUST00000022226] [ENSMUST00000069187]
Predicted Effect probably benign
Transcript: ENSMUST00000022225
SMART Domains Protein: ENSMUSP00000022225
Gene: ENSMUSG00000021712

DomainStartEndE-ValueType
RING 31 75 3.07e-5 SMART
BBOX 122 168 3.07e-1 SMART
BBOX 173 219 1.32e-4 SMART
BBC 226 370 2.89e-41 SMART
ARF 387 569 1.15e-78 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000022226
AA Change: T595A

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000022226
Gene: ENSMUSG00000021713
AA Change: T595A

DomainStartEndE-ValueType
WD40 80 117 2.96e-2 SMART
WD40 122 161 8.49e-3 SMART
Blast:WD40 164 207 9e-6 BLAST
WD40 211 251 2.76e0 SMART
WD40 269 308 1.4e-3 SMART
Blast:WD40 343 382 2e-6 BLAST
Blast:WD40 433 460 3e-7 BLAST
Pfam:Pro_isomerase 493 645 1.9e-52 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000069187
SMART Domains Protein: ENSMUSP00000070767
Gene: ENSMUSG00000021712

DomainStartEndE-ValueType
RING 31 75 3.07e-5 SMART
BBOX 122 168 3.07e-1 SMART
BBOX 173 219 5.95e-3 SMART
BBC 182 309 8.07e-22 SMART
ARF 326 508 1.15e-78 SMART
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.5%
  • 10x: 96.9%
  • 20x: 93.8%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 39 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2700049A03Rik G T 12: 71,164,546 E685* probably null Het
2700049A03Rik A T 12: 71,164,547 E685V possibly damaging Het
Aarsd1 T A 11: 101,414,078 I64F probably damaging Het
Agrn T A 4: 156,176,516 D574V probably damaging Het
Atg4b T C 1: 93,784,842 C16R probably damaging Het
Ccdc141 A T 2: 77,011,542 L1515Q probably damaging Het
Ccdc141 A T 2: 77,074,998 V368E probably benign Het
Clk1 A T 1: 58,421,289 S61T probably benign Het
Dhx38 A T 8: 109,556,140 D631E probably damaging Het
Dner C G 1: 84,370,823 E719Q probably damaging Het
E030025P04Rik G A 11: 109,144,054 Q3* probably null Het
Eif4g2 T A 7: 111,075,046 T613S probably benign Het
Fn1 C G 1: 71,648,119 G193A probably damaging Het
Gls2 A G 10: 128,203,842 E286G probably damaging Het
Gm21286 A G 4: 60,838,284 noncoding transcript Het
Gm6614 G A 6: 141,990,480 S293F probably benign Het
Gm813 T C 16: 58,615,876 probably null Het
Hoxa13 A T 6: 52,259,145 V304D probably damaging Het
Hpse2 A T 19: 42,931,622 M346K probably benign Het
Igkv1-99 A T 6: 68,542,497 probably benign Het
Kcnq2 A G 2: 181,112,107 Y237H probably damaging Het
Kmt2a T A 9: 44,820,910 probably benign Het
Kntc1 A G 5: 123,760,348 D180G probably damaging Het
Macf1 G A 4: 123,374,832 T4682M probably damaging Het
Mfsd6 T A 1: 52,708,410 H432L probably benign Het
Mgat5b T A 11: 116,919,496 D7E probably damaging Het
Msh6 G A 17: 87,984,731 V305I probably benign Het
Notch1 A T 2: 26,473,781 H880Q probably benign Het
Olfr117 A C 17: 37,659,931 V134G probably benign Het
Olfr1353 G A 10: 78,970,156 C169Y probably damaging Het
Olfr57 A T 10: 79,035,134 I113F possibly damaging Het
Pmepa1 G A 2: 173,228,133 R210W probably damaging Het
Pnliprp2 A G 19: 58,768,630 N308S probably benign Het
Prdm13 T C 4: 21,678,277 T738A possibly damaging Het
Rab11fip3 T A 17: 25,990,867 K1062* probably null Het
Reep3 A T 10: 67,096,790 V11E possibly damaging Het
Slco3a1 T C 7: 74,346,776 D294G probably benign Het
Sycp2 A G 2: 178,378,018 probably null Het
Zfp292 A G 4: 34,806,426 V2206A possibly damaging Het
Other mutations in Ppwd1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00321:Ppwd1 APN 13 104217143 missense probably damaging 1.00
IGL01582:Ppwd1 APN 13 104213704 missense probably benign 0.01
IGL01697:Ppwd1 APN 13 104220464 missense probably benign 0.01
IGL01771:Ppwd1 APN 13 104217116 missense probably damaging 1.00
IGL02414:Ppwd1 APN 13 104223137 missense probably benign
IGL02803:Ppwd1 APN 13 104213684 missense probably benign 0.00
IGL02873:Ppwd1 APN 13 104209753 missense probably damaging 1.00
F5770:Ppwd1 UTSW 13 104220237 missense probably damaging 0.98
R0462:Ppwd1 UTSW 13 104222960 critical splice acceptor site probably null
R1638:Ppwd1 UTSW 13 104220263 missense probably damaging 1.00
R2211:Ppwd1 UTSW 13 104207142 missense probably benign 0.26
R2226:Ppwd1 UTSW 13 104217245 missense probably damaging 1.00
R2299:Ppwd1 UTSW 13 104220063 missense probably benign
R2353:Ppwd1 UTSW 13 104213582 missense probably benign
R3123:Ppwd1 UTSW 13 104213690 missense possibly damaging 0.90
R4521:Ppwd1 UTSW 13 104209659 missense probably benign 0.16
R4972:Ppwd1 UTSW 13 104220108 missense probably benign 0.00
R5125:Ppwd1 UTSW 13 104220435 missense probably benign 0.14
R5178:Ppwd1 UTSW 13 104220435 missense probably benign 0.14
R5468:Ppwd1 UTSW 13 104225444 missense possibly damaging 0.52
R5638:Ppwd1 UTSW 13 104220398 missense probably damaging 1.00
R6748:Ppwd1 UTSW 13 104208030 nonsense probably null
R7095:Ppwd1 UTSW 13 104205626 missense probably benign 0.21
R7201:Ppwd1 UTSW 13 104207172 missense probably damaging 1.00
R7206:Ppwd1 UTSW 13 104213598 missense probably damaging 0.99
R7664:Ppwd1 UTSW 13 104220290 missense probably damaging 1.00
R7746:Ppwd1 UTSW 13 104217206 missense probably damaging 1.00
V7580:Ppwd1 UTSW 13 104220237 missense probably damaging 0.98
V7581:Ppwd1 UTSW 13 104220237 missense probably damaging 0.98
Predicted Primers PCR Primer
(F):5'- CACATTGCCTACTAGACAGAAATAGTG -3'
(R):5'- AGAGATAACTGCACTTCATATACCC -3'

Sequencing Primer
(F):5'- GCCTACTAGACAGAAATAGTGTTTTC -3'
(R):5'- ATACTTTCTGTTACCAGGGCTTCATG -3'
Posted On2014-11-11