Incidental Mutation 'R2382:Rab11fip3'
ID247584
Institutional Source Beutler Lab
Gene Symbol Rab11fip3
Ensembl Gene ENSMUSG00000037098
Gene NameRAB11 family interacting protein 3 (class II)
SynonymsD030060O14Rik, Rab11-FIP3
MMRRC Submission 040357-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R2382 (G1)
Quality Score225
Status Not validated
Chromosome17
Chromosomal Location25989036-26069409 bp(-) (GRCm38)
Type of Mutationnonsense
DNA Base Change (assembly) T to A at 25990867 bp
ZygosityHeterozygous
Amino Acid Change Lysine to Stop codon at position 1062 (K1062*)
Ref Sequence ENSEMBL: ENSMUSP00000113521 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000118828] [ENSMUST00000120691] [ENSMUST00000122103]
Predicted Effect probably null
Transcript: ENSMUST00000118828
AA Change: K414*
SMART Domains Protein: ENSMUSP00000113048
Gene: ENSMUSG00000037098
AA Change: K414*

DomainStartEndE-ValueType
low complexity region 136 148 N/A INTRINSIC
low complexity region 313 333 N/A INTRINSIC
Blast:BRLZ 335 385 2e-11 BLAST
Pfam:RBD-FIP 404 444 2.8e-18 PFAM
Predicted Effect probably null
Transcript: ENSMUST00000120691
AA Change: K1017*
SMART Domains Protein: ENSMUSP00000112875
Gene: ENSMUSG00000037098
AA Change: K1017*

DomainStartEndE-ValueType
internal_repeat_1 29 130 3.12e-31 PROSPERO
internal_repeat_1 144 294 3.12e-31 PROSPERO
EFh 500 528 3.03e-1 SMART
EFh 532 560 3.86e1 SMART
low complexity region 739 751 N/A INTRINSIC
low complexity region 916 936 N/A INTRINSIC
Blast:BRLZ 938 988 2e-11 BLAST
Pfam:RBD-FIP 1007 1047 4.7e-18 PFAM
Predicted Effect probably null
Transcript: ENSMUST00000122103
AA Change: K1062*
SMART Domains Protein: ENSMUSP00000113521
Gene: ENSMUSG00000037098
AA Change: K1062*

DomainStartEndE-ValueType
internal_repeat_1 29 130 2.03e-32 PROSPERO
internal_repeat_1 144 294 2.03e-32 PROSPERO
EFh 500 528 3.03e-1 SMART
EFh 532 560 3.86e1 SMART
low complexity region 784 796 N/A INTRINSIC
low complexity region 961 981 N/A INTRINSIC
Blast:BRLZ 983 1033 2e-11 BLAST
Pfam:RBD-FIP 1052 1092 4.9e-18 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000180932
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.5%
  • 10x: 96.9%
  • 20x: 93.8%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Proteins of the large Rab GTPase family (see RAB1A; MIM 179508) have regulatory roles in the formation, targeting, and fusion of intracellular transport vesicles. RAB11FIP3 is one of many proteins that interact with and regulate Rab GTPases (Hales et al., 2001 [PubMed 11495908]).[supplied by OMIM, Mar 2008]
Allele List at MGI
Other mutations in this stock
Total: 39 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2700049A03Rik G T 12: 71,164,546 E685* probably null Het
2700049A03Rik A T 12: 71,164,547 E685V possibly damaging Het
Aarsd1 T A 11: 101,414,078 I64F probably damaging Het
Agrn T A 4: 156,176,516 D574V probably damaging Het
Atg4b T C 1: 93,784,842 C16R probably damaging Het
Ccdc141 A T 2: 77,011,542 L1515Q probably damaging Het
Ccdc141 A T 2: 77,074,998 V368E probably benign Het
Clk1 A T 1: 58,421,289 S61T probably benign Het
Dhx38 A T 8: 109,556,140 D631E probably damaging Het
Dner C G 1: 84,370,823 E719Q probably damaging Het
E030025P04Rik G A 11: 109,144,054 Q3* probably null Het
Eif4g2 T A 7: 111,075,046 T613S probably benign Het
Fn1 C G 1: 71,648,119 G193A probably damaging Het
Gls2 A G 10: 128,203,842 E286G probably damaging Het
Gm21286 A G 4: 60,838,284 noncoding transcript Het
Gm6614 G A 6: 141,990,480 S293F probably benign Het
Gm813 T C 16: 58,615,876 probably null Het
Hoxa13 A T 6: 52,259,145 V304D probably damaging Het
Hpse2 A T 19: 42,931,622 M346K probably benign Het
Igkv1-99 A T 6: 68,542,497 probably benign Het
Kcnq2 A G 2: 181,112,107 Y237H probably damaging Het
Kmt2a T A 9: 44,820,910 probably benign Het
Kntc1 A G 5: 123,760,348 D180G probably damaging Het
Macf1 G A 4: 123,374,832 T4682M probably damaging Het
Mfsd6 T A 1: 52,708,410 H432L probably benign Het
Mgat5b T A 11: 116,919,496 D7E probably damaging Het
Msh6 G A 17: 87,984,731 V305I probably benign Het
Notch1 A T 2: 26,473,781 H880Q probably benign Het
Olfr117 A C 17: 37,659,931 V134G probably benign Het
Olfr1353 G A 10: 78,970,156 C169Y probably damaging Het
Olfr57 A T 10: 79,035,134 I113F possibly damaging Het
Pmepa1 G A 2: 173,228,133 R210W probably damaging Het
Pnliprp2 A G 19: 58,768,630 N308S probably benign Het
Ppwd1 T C 13: 104,207,113 T595A probably damaging Het
Prdm13 T C 4: 21,678,277 T738A possibly damaging Het
Reep3 A T 10: 67,096,790 V11E possibly damaging Het
Slco3a1 T C 7: 74,346,776 D294G probably benign Het
Sycp2 A G 2: 178,378,018 probably null Het
Zfp292 A G 4: 34,806,426 V2206A possibly damaging Het
Other mutations in Rab11fip3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00419:Rab11fip3 APN 17 25991809 splice site probably benign
IGL00420:Rab11fip3 APN 17 26067625 missense probably benign 0.20
IGL01291:Rab11fip3 APN 17 26016113 missense probably damaging 0.99
IGL01473:Rab11fip3 APN 17 26068735 missense possibly damaging 0.53
IGL01687:Rab11fip3 APN 17 26067982 missense possibly damaging 0.96
IGL01764:Rab11fip3 APN 17 26068693 missense probably benign 0.02
IGL01977:Rab11fip3 APN 17 26068003 missense possibly damaging 0.72
IGL02140:Rab11fip3 APN 17 26067892 missense probably benign 0.33
IGL02434:Rab11fip3 APN 17 26068835 missense possibly damaging 0.85
IGL02549:Rab11fip3 APN 17 25994320 missense probably damaging 0.96
IGL02889:Rab11fip3 APN 17 26067679 missense possibly damaging 0.84
IGL02953:Rab11fip3 APN 17 26067679 missense possibly damaging 0.84
ANU05:Rab11fip3 UTSW 17 26016113 missense probably damaging 0.99
R0193:Rab11fip3 UTSW 17 25990999 missense probably damaging 0.99
R0388:Rab11fip3 UTSW 17 26069072 missense probably benign 0.33
R0543:Rab11fip3 UTSW 17 25994225 missense probably damaging 1.00
R0678:Rab11fip3 UTSW 17 26068847 missense probably benign 0.00
R1283:Rab11fip3 UTSW 17 26004554 missense probably damaging 1.00
R1473:Rab11fip3 UTSW 17 25991322 missense probably damaging 1.00
R1625:Rab11fip3 UTSW 17 26068891 missense possibly damaging 0.72
R1973:Rab11fip3 UTSW 17 26024391 missense probably damaging 0.97
R2160:Rab11fip3 UTSW 17 26069054 missense probably benign 0.33
R2197:Rab11fip3 UTSW 17 26068178 missense probably benign
R3028:Rab11fip3 UTSW 17 26015942 critical splice donor site probably null
R3797:Rab11fip3 UTSW 17 26068526 missense possibly damaging 0.73
R4012:Rab11fip3 UTSW 17 26068028 frame shift probably null
R4064:Rab11fip3 UTSW 17 26024394 missense probably damaging 0.97
R4478:Rab11fip3 UTSW 17 26016083 missense probably damaging 1.00
R4527:Rab11fip3 UTSW 17 26036657 missense probably damaging 1.00
R4565:Rab11fip3 UTSW 17 26068706 missense possibly damaging 0.73
R5048:Rab11fip3 UTSW 17 26067580 critical splice donor site probably null
R5138:Rab11fip3 UTSW 17 25991026 missense probably benign 0.32
R5317:Rab11fip3 UTSW 17 26068078 missense possibly damaging 0.72
R5453:Rab11fip3 UTSW 17 25992581 critical splice donor site probably null
R5495:Rab11fip3 UTSW 17 26016143 missense probably damaging 0.99
R5525:Rab11fip3 UTSW 17 25991295 missense probably damaging 1.00
R5654:Rab11fip3 UTSW 17 26016064 missense probably damaging 1.00
R5716:Rab11fip3 UTSW 17 26036664 missense probably damaging 1.00
R5818:Rab11fip3 UTSW 17 26016116 missense probably damaging 1.00
R6044:Rab11fip3 UTSW 17 26067869 missense possibly damaging 0.93
R6716:Rab11fip3 UTSW 17 25991057 missense probably damaging 1.00
R6785:Rab11fip3 UTSW 17 25991718 missense probably damaging 0.99
R7161:Rab11fip3 UTSW 17 26069090 missense probably benign 0.09
R7390:Rab11fip3 UTSW 17 26068152 missense possibly damaging 0.81
R7447:Rab11fip3 UTSW 17 26068874 missense possibly damaging 0.66
Predicted Primers PCR Primer
(F):5'- TTGGTAAGCTGCAGGACCTG -3'
(R):5'- ATGGGCAGATCATCACCCTCAG -3'

Sequencing Primer
(F):5'- ACCTGCTGGTCGGGCTC -3'
(R):5'- GGTGCCAAGAGCCTCTTCTC -3'
Posted On2014-11-11