Mutagenetix > Incidental Mutations

Incidental Mutation 'R2382:Pnliprp2'

247588

Institutional Source

Beutler Lab

Gene Symbol

Pnliprp2

Ensembl Gene

ENSMUSG00000025091

Gene Name

pancreatic lipase-related protein 2

Synonyms

PLRP2

MMRRC Submission

040357-MU

Accession Numbers

Is this an essential gene?

Probably non essential (E-score: 0.093) question?

Stock #

R2382 (G1)

Quality Score

225

Status

Not validated

Chromosome

Chromosomal Location

58759723-58777533 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to G at 58768630 bp

Zygosity

Heterozygous

Amino Acid Change

Asparagine to Serine at position 308 (N308S)

Ref Sequence

ENSEMBL: ENSMUSP00000026081 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000026081]

Predicted Effect

probably benign
Transcript: ENSMUST00000026081
AA Change: N308S

PolyPhen 2 Score 0.004 (Sensitivity: 0.98; Specificity: 0.59)

SMART Domains

Protein: ENSMUSP00000026081
Gene: ENSMUSG00000025091
AA Change: N308S

Domain	Start	End	E-Value	Type
signal peptide	1	30	N/A	INTRINSIC
Pfam:Lipase	31	367	4.1e-166	PFAM
LH2	370	482	7.49e-27	SMART

Coding Region Coverage

1x: 99.1%
3x: 98.5%
10x: 96.9%
20x: 93.8%

Validation Efficiency

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a lipase that hydrolyzes galactolipids, the main components of plant membrane lipids. An allelic polymorphism in this gene results in both coding and non-coding variants; the reference genome represents the non-coding allele. [provided by RefSeq, Aug 2015]
PHENOTYPE: Mice homozygous for disruptions in this gene display deficient lipid absorbtion before weaning which results in growth retardation. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 39 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
2700049A03Rik	G	T	12: 71,164,546	E685*	probably null	Het
2700049A03Rik	A	T	12: 71,164,547	E685V	possibly damaging	Het
Aarsd1	T	A	11: 101,414,078	I64F	probably damaging	Het
Agrn	T	A	4: 156,176,516	D574V	probably damaging	Het
Atg4b	T	C	1: 93,784,842	C16R	probably damaging	Het
Ccdc141	A	T	2: 77,011,542	L1515Q	probably damaging	Het
Ccdc141	A	T	2: 77,074,998	V368E	probably benign	Het
Clk1	A	T	1: 58,421,289	S61T	probably benign	Het
Dhx38	A	T	8: 109,556,140	D631E	probably damaging	Het
Dner	C	G	1: 84,370,823	E719Q	probably damaging	Het
E030025P04Rik	G	A	11: 109,144,054	Q3*	probably null	Het
Eif4g2	T	A	7: 111,075,046	T613S	probably benign	Het
Fn1	C	G	1: 71,648,119	G193A	probably damaging	Het
Gls2	A	G	10: 128,203,842	E286G	probably damaging	Het
Gm21286	A	G	4: 60,838,284		noncoding transcript	Het
Gm6614	G	A	6: 141,990,480	S293F	probably benign	Het
Gm813	T	C	16: 58,615,876		probably null	Het
Hoxa13	A	T	6: 52,259,145	V304D	probably damaging	Het
Hpse2	A	T	19: 42,931,622	M346K	probably benign	Het
Igkv1-99	A	T	6: 68,542,497		probably benign	Het
Kcnq2	A	G	2: 181,112,107	Y237H	probably damaging	Het
Kmt2a	T	A	9: 44,820,910		probably benign	Het
Kntc1	A	G	5: 123,760,348	D180G	probably damaging	Het
Macf1	G	A	4: 123,374,832	T4682M	probably damaging	Het
Mfsd6	T	A	1: 52,708,410	H432L	probably benign	Het
Mgat5b	T	A	11: 116,919,496	D7E	probably damaging	Het
Msh6	G	A	17: 87,984,731	V305I	probably benign	Het
Notch1	A	T	2: 26,473,781	H880Q	probably benign	Het
Olfr117	A	C	17: 37,659,931	V134G	probably benign	Het
Olfr1353	G	A	10: 78,970,156	C169Y	probably damaging	Het
Olfr57	A	T	10: 79,035,134	I113F	possibly damaging	Het
Pmepa1	G	A	2: 173,228,133	R210W	probably damaging	Het
Ppwd1	T	C	13: 104,207,113	T595A	probably damaging	Het
Prdm13	T	C	4: 21,678,277	T738A	possibly damaging	Het
Rab11fip3	T	A	17: 25,990,867	K1062*	probably null	Het
Reep3	A	T	10: 67,096,790	V11E	possibly damaging	Het
Slco3a1	T	C	7: 74,346,776	D294G	probably benign	Het
Sycp2	A	G	2: 178,378,018		probably null	Het
Zfp292	A	G	4: 34,806,426	V2206A	possibly damaging	Het

Other mutations in Pnliprp2

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00786:Pnliprp2	APN	19	58760497	missense	probably benign
IGL02739:Pnliprp2	APN	19	58760509	critical splice donor site	probably null
IGL02881:Pnliprp2	APN	19	58771446	missense	probably benign	0.01
IGL03411:Pnliprp2	APN	19	58760415	missense	probably benign
R0140:Pnliprp2	UTSW	19	58766363	missense	probably benign	0.00
R0558:Pnliprp2	UTSW	19	58774087	missense	probably benign	0.00
R1873:Pnliprp2	UTSW	19	58763389	missense	probably benign	0.00
R1874:Pnliprp2	UTSW	19	58763389	missense	probably benign	0.00
R1875:Pnliprp2	UTSW	19	58763389	missense	probably benign	0.00
R3893:Pnliprp2	UTSW	19	58766273	missense	probably benign	0.19
R3915:Pnliprp2	UTSW	19	58760362	missense	probably damaging	1.00
R4620:Pnliprp2	UTSW	19	58762286	missense	possibly damaging	0.67
R4893:Pnliprp2	UTSW	19	58771421	missense	probably benign	0.08
R4957:Pnliprp2	UTSW	19	58775145	missense	possibly damaging	0.72
R4959:Pnliprp2	UTSW	19	58766318	missense	probably benign	0.16
R4973:Pnliprp2	UTSW	19	58766318	missense	probably benign	0.16
R5346:Pnliprp2	UTSW	19	58759800	missense	probably benign
R6049:Pnliprp2	UTSW	19	58760452	missense	possibly damaging	0.77
R6228:Pnliprp2	UTSW	19	58763442	critical splice donor site	probably null
R6394:Pnliprp2	UTSW	19	58761598	missense	probably benign
R6829:Pnliprp2	UTSW	19	58759873	missense	probably benign
R7235:Pnliprp2	UTSW	19	58775227	missense	probably benign	0.03
R7534:Pnliprp2	UTSW	19	58775142	missense	probably benign
X0058:Pnliprp2	UTSW	19	58774142	missense	possibly damaging	0.59
Z1088:Pnliprp2	UTSW	19	58762325	missense	probably damaging	1.00

Predicted Primers

PCR Primer
(F):5'- TTGTCAGTCTTCAGCAGCTC -3'
(R):5'- TTGAAAACTTCTGCATGTCCCC -3'

Sequencing Primer
(F):5'- AGTCTTCAGCAGCTCCCTGG -3'
(R):5'- GAAAACTTCTGCATGTCCCCTCTAC -3'

Posted On

2014-11-11