Incidental Mutation 'R2383:Plrg1'
ID247596
Institutional Source Beutler Lab
Gene Symbol Plrg1
Ensembl Gene ENSMUSG00000027998
Gene Namepleiotropic regulator 1
SynonymsTango4
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R2383 (G1)
Quality Score225
Status Not validated
Chromosome3
Chromosomal Location83055522-83072355 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to T at 83065948 bp
ZygosityHeterozygous
Amino Acid Change Proline to Serine at position 178 (P178S)
Ref Sequence ENSEMBL: ENSMUSP00000113614 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000029628] [ENSMUST00000122128] [ENSMUST00000150268]
Predicted Effect probably damaging
Transcript: ENSMUST00000029628
AA Change: P187S

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000029628
Gene: ENSMUSG00000027998
AA Change: P187S

DomainStartEndE-ValueType
WD40 192 231 1.92e-10 SMART
WD40 234 273 1.68e-6 SMART
WD40 276 315 1.96e-7 SMART
WD40 318 357 5.95e-7 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000122128
AA Change: P178S

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000113614
Gene: ENSMUSG00000027998
AA Change: P178S

DomainStartEndE-ValueType
WD40 183 222 1.92e-10 SMART
WD40 225 264 1.68e-6 SMART
WD40 267 306 1.96e-7 SMART
WD40 309 348 5.95e-7 SMART
WD40 351 389 1.12e-2 SMART
WD40 392 430 5.47e-6 SMART
WD40 442 480 5.97e-1 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000135813
Predicted Effect probably damaging
Transcript: ENSMUST00000150268
AA Change: P187S

PolyPhen 2 Score 0.982 (Sensitivity: 0.75; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000114968
Gene: ENSMUSG00000027998
AA Change: P187S

DomainStartEndE-ValueType
WD40 192 231 1.92e-10 SMART
WD40 234 273 1.68e-6 SMART
WD40 276 315 1.96e-7 SMART
WD40 318 357 5.95e-7 SMART
WD40 360 398 1.12e-2 SMART
WD40 401 439 5.47e-6 SMART
WD40 451 489 5.97e-1 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000151915
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.5%
  • 10x: 96.9%
  • 20x: 93.6%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a core component of the cell division cycle 5-like (CDC5L) complex. The CDC5L complex is part of the spliceosome and is required for pre-mRNA splicing. The encoded protein plays a critical role in alternative splice site selection. Alternatively spliced transcript variants encoding multiple isoforms have been observed for this gene. [provided by RefSeq, Jan 2011]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit embryonic lethality by E1.5. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 23 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adam33 T C 2: 131,051,362 T748A probably benign Het
Afg3l2 A G 18: 67,422,956 V435A possibly damaging Het
BC005561 T C 5: 104,518,988 S459P probably benign Het
BC048403 A G 10: 121,750,649 T290A possibly damaging Het
Ccdc170 G A 10: 4,534,208 E345K probably benign Het
Chd2 T C 7: 73,503,420 I227V possibly damaging Het
Cndp2 C A 18: 84,675,090 D182Y possibly damaging Het
Col14a1 A T 15: 55,447,517 probably benign Het
Cyp2e1 C T 7: 140,770,068 S222L probably benign Het
Evx2 T C 2: 74,658,049 probably null Het
L1td1 A G 4: 98,737,722 E718G possibly damaging Het
Lgr4 T C 2: 110,000,615 S296P probably damaging Het
Lrrc7 T C 3: 158,163,956 M709V probably benign Het
Mtbp G A 15: 55,566,194 G162D probably damaging Het
Nap1l1 T G 10: 111,493,411 D295E probably damaging Het
Olfr38 A T 6: 42,762,459 M136L probably benign Het
Serpina1b T A 12: 103,728,280 I402F probably benign Het
Sla T A 15: 66,782,676 I254F probably damaging Het
Slc25a29 A G 12: 108,827,008 S215P probably damaging Het
Tiam1 A G 16: 89,798,684 V1303A probably benign Het
Trim45 A T 3: 100,925,227 I259F probably damaging Het
Ttn T C 2: 76,706,512 S34990G probably benign Het
Zbtb48 A G 4: 152,026,950 V36A probably damaging Het
Other mutations in Plrg1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00659:Plrg1 APN 3 83070673 missense probably damaging 0.99
IGL00824:Plrg1 APN 3 83068335 missense probably damaging 1.00
IGL00948:Plrg1 APN 3 83068119 missense probably damaging 1.00
IGL02550:Plrg1 APN 3 83061123 critical splice donor site probably null
R0743:Plrg1 UTSW 3 83059917 missense probably benign 0.11
R1624:Plrg1 UTSW 3 83067994 splice site probably benign
R1624:Plrg1 UTSW 3 83069744 missense probably damaging 1.00
R1630:Plrg1 UTSW 3 83058763 missense probably benign 0.00
R1876:Plrg1 UTSW 3 83069068 splice site probably benign
R2892:Plrg1 UTSW 3 83071240 missense probably damaging 1.00
R3406:Plrg1 UTSW 3 83071219 missense probably damaging 1.00
R5114:Plrg1 UTSW 3 83071251 missense probably benign 0.13
R5922:Plrg1 UTSW 3 83056848 missense possibly damaging 0.77
R6333:Plrg1 UTSW 3 83056795 missense probably damaging 1.00
R7127:Plrg1 UTSW 3 83059915 missense probably damaging 1.00
R7530:Plrg1 UTSW 3 83058682 missense probably damaging 1.00
R7814:Plrg1 UTSW 3 83056837 missense probably damaging 1.00
R8123:Plrg1 UTSW 3 83065930 missense probably benign 0.16
R8131:Plrg1 UTSW 3 83069774 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- AAAAGGTATCTTAGCTGTCTTCCTC -3'
(R):5'- CCGCCACAGTGAAGAACTTTC -3'

Sequencing Primer
(F):5'- AGCTGTCTTCCTCTTCAGTTAATG -3'
(R):5'- AAGAACTTTCTTAGTCACCTGCTC -3'
Posted On2014-11-11