Incidental Mutation 'R2383:Trim45'
ID247597
Institutional Source Beutler Lab
Gene Symbol Trim45
Ensembl Gene ENSMUSG00000033233
Gene Nametripartite motif-containing 45
Synonyms4921530N01Rik
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R2383 (G1)
Quality Score225
Status Not validated
Chromosome3
Chromosomal Location100922202-100936920 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 100925227 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Phenylalanine at position 259 (I259F)
Ref Sequence ENSEMBL: ENSMUSP00000115669 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000037409] [ENSMUST00000094048] [ENSMUST00000106980] [ENSMUST00000134993]
Predicted Effect possibly damaging
Transcript: ENSMUST00000037409
AA Change: I259F

PolyPhen 2 Score 0.827 (Sensitivity: 0.84; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000043389
Gene: ENSMUSG00000033233
AA Change: I259F

DomainStartEndE-ValueType
RING 29 97 5.35e-5 SMART
BBOX 130 176 1.03e-1 SMART
BBOX 186 227 4.34e-5 SMART
BBC 234 360 3.55e-9 SMART
IG_FLMN 398 500 7.63e-33 SMART
low complexity region 532 549 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000094048
AA Change: I210F

PolyPhen 2 Score 0.164 (Sensitivity: 0.92; Specificity: 0.87)
SMART Domains Protein: ENSMUSP00000091590
Gene: ENSMUSG00000033233
AA Change: I210F

DomainStartEndE-ValueType
BBOX 81 127 1.03e-1 SMART
BBOX 137 178 4.34e-5 SMART
BBC 185 311 3.55e-9 SMART
IG_FLMN 349 451 7.63e-33 SMART
low complexity region 483 500 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000106980
AA Change: I259F

PolyPhen 2 Score 0.827 (Sensitivity: 0.84; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000102593
Gene: ENSMUSG00000033233
AA Change: I259F

DomainStartEndE-ValueType
RING 29 97 5.35e-5 SMART
BBOX 130 176 1.03e-1 SMART
BBOX 186 227 4.34e-5 SMART
BBC 234 360 3.55e-9 SMART
IG_FLMN 398 500 7.63e-33 SMART
low complexity region 532 549 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000134993
AA Change: I259F

PolyPhen 2 Score 0.968 (Sensitivity: 0.77; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000115669
Gene: ENSMUSG00000033233
AA Change: I259F

DomainStartEndE-ValueType
RING 29 97 5.35e-5 SMART
BBOX 130 176 1.03e-1 SMART
BBOX 186 227 4.34e-5 SMART
BBC 234 360 3.55e-9 SMART
IG_FLMN 398 500 7.63e-33 SMART
Predicted Effect possibly damaging
Transcript: ENSMUST00000163914
AA Change: I259F

PolyPhen 2 Score 0.946 (Sensitivity: 0.80; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000129861
Gene: ENSMUSG00000033233
AA Change: I259F

DomainStartEndE-ValueType
RING 29 97 5.35e-5 SMART
BBOX 130 176 1.03e-1 SMART
BBOX 186 227 4.34e-5 SMART
BBC 234 360 3.55e-9 SMART
IG_FLMN 398 500 7.63e-33 SMART
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.5%
  • 10x: 96.9%
  • 20x: 93.6%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the tripartite motif family. The encoded protein may function as a transcriptional repressor of the mitogen-activated protein kinase pathway. Alternatively spliced transcript variants have been described.[provided by RefSeq, Mar 2009]
Allele List at MGI
Other mutations in this stock
Total: 23 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adam33 T C 2: 131,051,362 T748A probably benign Het
Afg3l2 A G 18: 67,422,956 V435A possibly damaging Het
BC005561 T C 5: 104,518,988 S459P probably benign Het
BC048403 A G 10: 121,750,649 T290A possibly damaging Het
Ccdc170 G A 10: 4,534,208 E345K probably benign Het
Chd2 T C 7: 73,503,420 I227V possibly damaging Het
Cndp2 C A 18: 84,675,090 D182Y possibly damaging Het
Col14a1 A T 15: 55,447,517 probably benign Het
Cyp2e1 C T 7: 140,770,068 S222L probably benign Het
Evx2 T C 2: 74,658,049 probably null Het
L1td1 A G 4: 98,737,722 E718G possibly damaging Het
Lgr4 T C 2: 110,000,615 S296P probably damaging Het
Lrrc7 T C 3: 158,163,956 M709V probably benign Het
Mtbp G A 15: 55,566,194 G162D probably damaging Het
Nap1l1 T G 10: 111,493,411 D295E probably damaging Het
Olfr38 A T 6: 42,762,459 M136L probably benign Het
Plrg1 C T 3: 83,065,948 P178S probably damaging Het
Serpina1b T A 12: 103,728,280 I402F probably benign Het
Sla T A 15: 66,782,676 I254F probably damaging Het
Slc25a29 A G 12: 108,827,008 S215P probably damaging Het
Tiam1 A G 16: 89,798,684 V1303A probably benign Het
Ttn T C 2: 76,706,512 S34990G probably benign Het
Zbtb48 A G 4: 152,026,950 V36A probably damaging Het
Other mutations in Trim45
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00802:Trim45 APN 3 100931726 intron probably benign
IGL01472:Trim45 APN 3 100928065 missense probably benign 0.00
IGL01996:Trim45 APN 3 100928109 nonsense probably null 0.00
IGL02392:Trim45 APN 3 100925305 missense probably benign 0.04
IGL03229:Trim45 APN 3 100923069 missense probably damaging 1.00
IGL02837:Trim45 UTSW 3 100931627 intron probably benign
R0021:Trim45 UTSW 3 100925420 missense probably damaging 1.00
R0243:Trim45 UTSW 3 100929844 missense probably benign 0.05
R0501:Trim45 UTSW 3 100923219 missense probably damaging 1.00
R1222:Trim45 UTSW 3 100927298 missense probably benign 0.14
R1418:Trim45 UTSW 3 100927298 missense probably benign 0.14
R1813:Trim45 UTSW 3 100922967 missense probably benign 0.16
R2148:Trim45 UTSW 3 100932044 nonsense probably null
R4368:Trim45 UTSW 3 100923186 missense probably damaging 1.00
R4769:Trim45 UTSW 3 100931734 intron probably benign
R4840:Trim45 UTSW 3 100925488 missense possibly damaging 0.95
R5030:Trim45 UTSW 3 100928072 missense probably damaging 1.00
R5272:Trim45 UTSW 3 100929919 missense probably damaging 1.00
R5298:Trim45 UTSW 3 100925471 missense probably damaging 1.00
R5498:Trim45 UTSW 3 100925141 missense possibly damaging 0.67
R5589:Trim45 UTSW 3 100929941 missense probably damaging 1.00
R6537:Trim45 UTSW 3 100925396 missense probably benign 0.39
R6850:Trim45 UTSW 3 100923225 nonsense probably null
R7009:Trim45 UTSW 3 100931879 intron probably benign
R7122:Trim45 UTSW 3 100932037 missense unknown
R7583:Trim45 UTSW 3 100925023 missense probably damaging 1.00
X0066:Trim45 UTSW 3 100931767 intron probably benign
Z1088:Trim45 UTSW 3 100925640 missense probably benign 0.11
Predicted Primers PCR Primer
(F):5'- CTACAGCCAGGTTGGAAAGC -3'
(R):5'- CTTTCTGCAGCTGTAAAGCGG -3'

Sequencing Primer
(F):5'- GGTTGGAAAGCCCATCCTATGTC -3'
(R):5'- AGCTGTAAAGCGGTTTCCC -3'
Posted On2014-11-11