Incidental Mutation 'R2383:L1td1'
ID247599
Institutional Source Beutler Lab
Gene Symbol L1td1
Ensembl Gene ENSMUSG00000087166
Gene NameLINE-1 type transposase domain containing 1
SynonymsECAT11
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.095) question?
Stock #R2383 (G1)
Quality Score225
Status Not validated
Chromosome4
Chromosomal Location98726734-98738480 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 98737722 bp
ZygosityHeterozygous
Amino Acid Change Glutamic Acid to Glycine at position 718 (E718G)
Ref Sequence ENSEMBL: ENSMUSP00000134149 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000152889] [ENSMUST00000154279] [ENSMUST00000171708] [ENSMUST00000173659]
Predicted Effect probably benign
Transcript: ENSMUST00000152889
Predicted Effect possibly damaging
Transcript: ENSMUST00000154279
AA Change: E652G

PolyPhen 2 Score 0.932 (Sensitivity: 0.80; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000127504
Gene: ENSMUSG00000087166
AA Change: E652G

DomainStartEndE-ValueType
Pfam:Transposase_22 175 295 4e-21 PFAM
low complexity region 346 397 N/A INTRINSIC
low complexity region 402 413 N/A INTRINSIC
Pfam:Transposase_22 495 782 2.2e-59 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000171708
Predicted Effect possibly damaging
Transcript: ENSMUST00000173659
AA Change: E718G

PolyPhen 2 Score 0.932 (Sensitivity: 0.80; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000134149
Gene: ENSMUSG00000087166
AA Change: E718G

DomainStartEndE-ValueType
Pfam:Transposase_22 175 291 6e-20 PFAM
coiled coil region 383 431 N/A INTRINSIC
low complexity region 468 479 N/A INTRINSIC
Pfam:Transposase_22 568 848 4.3e-57 PFAM
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.5%
  • 10x: 96.9%
  • 20x: 93.6%
Validation Efficiency
MGI Phenotype PHENOTYPE: Mice homozygous for a knock-out allele exhibit normal development and fertility. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 23 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adam33 T C 2: 131,051,362 T748A probably benign Het
Afg3l2 A G 18: 67,422,956 V435A possibly damaging Het
BC005561 T C 5: 104,518,988 S459P probably benign Het
BC048403 A G 10: 121,750,649 T290A possibly damaging Het
Ccdc170 G A 10: 4,534,208 E345K probably benign Het
Chd2 T C 7: 73,503,420 I227V possibly damaging Het
Cndp2 C A 18: 84,675,090 D182Y possibly damaging Het
Col14a1 A T 15: 55,447,517 probably benign Het
Cyp2e1 C T 7: 140,770,068 S222L probably benign Het
Evx2 T C 2: 74,658,049 probably null Het
Lgr4 T C 2: 110,000,615 S296P probably damaging Het
Lrrc7 T C 3: 158,163,956 M709V probably benign Het
Mtbp G A 15: 55,566,194 G162D probably damaging Het
Nap1l1 T G 10: 111,493,411 D295E probably damaging Het
Olfr38 A T 6: 42,762,459 M136L probably benign Het
Plrg1 C T 3: 83,065,948 P178S probably damaging Het
Serpina1b T A 12: 103,728,280 I402F probably benign Het
Sla T A 15: 66,782,676 I254F probably damaging Het
Slc25a29 A G 12: 108,827,008 S215P probably damaging Het
Tiam1 A G 16: 89,798,684 V1303A probably benign Het
Trim45 A T 3: 100,925,227 I259F probably damaging Het
Ttn T C 2: 76,706,512 S34990G probably benign Het
Zbtb48 A G 4: 152,026,950 V36A probably damaging Het
Other mutations in L1td1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01599:L1td1 APN 4 98737344 missense probably damaging 0.99
IGL02529:L1td1 APN 4 98737421 missense probably benign 0.01
R0254:L1td1 UTSW 4 98737182 nonsense probably null
R0924:L1td1 UTSW 4 98737625 missense probably damaging 1.00
R0930:L1td1 UTSW 4 98737625 missense probably damaging 1.00
R1434:L1td1 UTSW 4 98737817 missense possibly damaging 0.91
R1573:L1td1 UTSW 4 98737280 missense probably benign 0.01
R1751:L1td1 UTSW 4 98737449 missense probably benign 0.32
R1767:L1td1 UTSW 4 98737449 missense probably benign 0.32
R1870:L1td1 UTSW 4 98737477 missense possibly damaging 0.93
R2006:L1td1 UTSW 4 98733489 missense possibly damaging 0.53
R2252:L1td1 UTSW 4 98737637 unclassified probably null
R2472:L1td1 UTSW 4 98733159 unclassified probably benign
R3195:L1td1 UTSW 4 98737518 missense possibly damaging 0.47
R3763:L1td1 UTSW 4 98737835 missense probably damaging 0.99
R3950:L1td1 UTSW 4 98737353 missense probably benign 0.12
R3962:L1td1 UTSW 4 98737449 missense probably benign 0.32
R4430:L1td1 UTSW 4 98737151 missense probably benign 0.00
R4643:L1td1 UTSW 4 98737883 missense probably damaging 0.98
R4661:L1td1 UTSW 4 98733624 missense possibly damaging 0.94
R4885:L1td1 UTSW 4 98737311 missense probably benign 0.01
R5345:L1td1 UTSW 4 98736447 missense probably damaging 1.00
R5589:L1td1 UTSW 4 98738104 missense possibly damaging 0.66
R5800:L1td1 UTSW 4 98733762 missense possibly damaging 0.96
R6207:L1td1 UTSW 4 98737418 missense possibly damaging 0.55
R6309:L1td1 UTSW 4 98737091 missense probably damaging 0.99
R6917:L1td1 UTSW 4 98734031 missense probably benign 0.18
R6945:L1td1 UTSW 4 98733696 missense probably benign 0.33
R7185:L1td1 UTSW 4 98736618 missense possibly damaging 0.72
R7258:L1td1 UTSW 4 98736864 missense probably benign 0.04
R7893:L1td1 UTSW 4 98733741 missense possibly damaging 0.73
R7976:L1td1 UTSW 4 98733741 missense possibly damaging 0.73
R8129:L1td1 UTSW 4 98733326 missense probably benign 0.01
RF019:L1td1 UTSW 4 98736824 missense not run
RF031:L1td1 UTSW 4 98736789 small deletion probably benign
RF039:L1td1 UTSW 4 98736789 small deletion probably benign
RF060:L1td1 UTSW 4 98736794 small deletion probably benign
Predicted Primers PCR Primer
(F):5'- TTAGCTTGCACGATTGAGGC -3'
(R):5'- TTTGGTGGACAGAGAGCAC -3'

Sequencing Primer
(F):5'- CTGACCAAGGATACAATGCAGTTAGC -3'
(R):5'- AGCACTCCAGGTTGCTAATG -3'
Posted On2014-11-11