Incidental Mutation 'R0288:Stk32a'
ID 24760
Institutional Source Beutler Lab
Gene Symbol Stk32a
Ensembl Gene ENSMUSG00000039954
Gene Name serine/threonine kinase 32A
Synonyms A930015B13Rik, YANK1
MMRRC Submission 038507-MU
Accession Numbers
Essential gene? Probably non essential (E-score: 0.074) question?
Stock # R0288 (G1)
Quality Score 225
Status Validated
Chromosome 18
Chromosomal Location 43340762-43450546 bp(+) (GRCm39)
Type of Mutation splice site
DNA Base Change (assembly) T to A at 43438060 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000038471 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000045477]
AlphaFold Q8BGW6
Predicted Effect probably null
Transcript: ENSMUST00000045477
SMART Domains Protein: ENSMUSP00000038471
Gene: ENSMUSG00000039954

DomainStartEndE-ValueType
S_TKc 23 281 9.58e-85 SMART
low complexity region 318 339 N/A INTRINSIC
Meta Mutation Damage Score 0.9755 question?
Coding Region Coverage
  • 1x: 98.8%
  • 3x: 97.8%
  • 10x: 95.1%
  • 20x: 89.7%
Validation Efficiency 98% (62/63)
Allele List at MGI
Other mutations in this stock
Total: 60 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adgrg3 A G 8: 95,766,568 (GRCm39) E413G possibly damaging Het
Amigo2 G T 15: 97,143,560 (GRCm39) N287K probably damaging Het
Ankle2 T A 5: 110,384,256 (GRCm39) I260K probably damaging Het
Apob C T 12: 8,040,779 (GRCm39) R635* probably null Het
Camkv A G 9: 107,823,555 (GRCm39) Y153C probably damaging Het
Capn9 A G 8: 125,327,230 (GRCm39) probably benign Het
Ces2c A G 8: 105,576,376 (GRCm39) I130V probably benign Het
Cfap44 T A 16: 44,236,257 (GRCm39) probably benign Het
Cfhr3 A G 1: 139,525,425 (GRCm39) noncoding transcript Het
Chmp1a G T 8: 123,934,745 (GRCm39) D70E probably damaging Het
Coil G A 11: 88,872,694 (GRCm39) G352R probably damaging Het
Colq T C 14: 31,265,949 (GRCm39) E188G possibly damaging Het
Cyfip2 A G 11: 46,144,799 (GRCm39) F685S possibly damaging Het
Cyp4f39 A G 17: 32,711,410 (GRCm39) N519S probably benign Het
Dennd1c A T 17: 57,383,870 (GRCm39) probably null Het
Dnah9 A T 11: 65,915,960 (GRCm39) probably null Het
Dnmbp T C 19: 43,890,898 (GRCm39) T290A possibly damaging Het
Dsc2 T C 18: 20,166,177 (GRCm39) D818G probably damaging Het
Gnptab G A 10: 88,268,967 (GRCm39) V557I probably benign Het
Hdac4 A T 1: 91,898,728 (GRCm39) H675Q probably damaging Het
Kcnk3 T C 5: 30,745,764 (GRCm39) M35T probably benign Het
Kif1b A T 4: 149,283,795 (GRCm39) I1290N probably damaging Het
Klhl14 G A 18: 21,698,620 (GRCm39) R398W probably damaging Het
Marveld1 T C 19: 42,136,265 (GRCm39) F60L probably damaging Het
Miox C T 15: 89,220,477 (GRCm39) L189F possibly damaging Het
Ncoa6 TGC TGCGC 2: 155,250,211 (GRCm39) probably null Het
Ndst3 A T 3: 123,465,843 (GRCm39) V43D probably benign Het
Nhsl1 A G 10: 18,399,794 (GRCm39) D306G probably damaging Het
Nlrp2 A G 7: 5,331,544 (GRCm39) V284A probably benign Het
Pcdhb15 T C 18: 37,608,451 (GRCm39) V561A probably damaging Het
Pdcl2 T C 5: 76,460,344 (GRCm39) I177V possibly damaging Het
Pkd1l3 G A 8: 110,373,131 (GRCm39) probably null Het
Pla2g6 A C 15: 79,171,106 (GRCm39) probably benign Het
Plekhj1 A T 10: 80,632,444 (GRCm39) I122N probably damaging Het
Pmel T C 10: 128,550,175 (GRCm39) I70T probably benign Het
Psip1 T C 4: 83,383,196 (GRCm39) D273G probably damaging Het
Rictor A G 15: 6,816,021 (GRCm39) I1098V probably benign Het
Rif1 T C 2: 52,000,025 (GRCm39) S1160P probably damaging Het
Rsbn1l T C 5: 21,125,038 (GRCm39) I255V probably damaging Het
Slc15a5 A G 6: 137,994,914 (GRCm39) probably benign Het
Slc29a1 G A 17: 45,900,730 (GRCm39) R111W probably damaging Het
Slc36a1 G A 11: 55,109,913 (GRCm39) A74T probably damaging Het
Slc5a7 A T 17: 54,600,046 (GRCm39) Y122* probably null Het
Slc6a3 G T 13: 73,709,047 (GRCm39) G324W probably damaging Het
Sltm T C 9: 70,486,633 (GRCm39) S433P probably damaging Het
Spta1 T C 1: 174,070,745 (GRCm39) S2190P probably damaging Het
Sry A T Y: 2,662,818 (GRCm39) F281I unknown Het
Sytl2 T C 7: 90,052,228 (GRCm39) probably benign Het
Tbl3 G A 17: 24,920,781 (GRCm39) H612Y probably damaging Het
Tmem144 G A 3: 79,746,580 (GRCm39) probably benign Het
Top2a A G 11: 98,907,249 (GRCm39) probably benign Het
Usp9y A T Y: 1,333,606 (GRCm39) probably benign Het
Vldlr G A 19: 27,218,051 (GRCm39) probably benign Het
Vmn1r28 G A 6: 58,242,702 (GRCm39) A182T probably benign Het
Vmn2r28 A G 7: 5,491,020 (GRCm39) L409P probably damaging Het
Vps13c T C 9: 67,834,648 (GRCm39) V1659A probably damaging Het
Wdr17 C T 8: 55,146,131 (GRCm39) A90T possibly damaging Het
Zfp280d A T 9: 72,238,621 (GRCm39) K646* probably null Het
Zfp36 A G 7: 28,077,666 (GRCm39) S81P probably benign Het
Zfp618 A T 4: 63,051,171 (GRCm39) T651S possibly damaging Het
Other mutations in Stk32a
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00502:Stk32a APN 18 43,443,510 (GRCm39) missense possibly damaging 0.46
IGL00704:Stk32a APN 18 43,394,314 (GRCm39) missense probably damaging 1.00
IGL00813:Stk32a APN 18 43,443,585 (GRCm39) missense probably benign 0.10
IGL02121:Stk32a APN 18 43,446,572 (GRCm39) missense probably benign
IGL02407:Stk32a APN 18 43,430,576 (GRCm39) missense probably benign 0.00
IGL02957:Stk32a APN 18 43,445,057 (GRCm39) missense probably benign
R0004:Stk32a UTSW 18 43,438,121 (GRCm39) missense probably damaging 1.00
R0047:Stk32a UTSW 18 43,446,443 (GRCm39) splice site probably benign
R0047:Stk32a UTSW 18 43,446,443 (GRCm39) splice site probably benign
R0330:Stk32a UTSW 18 43,446,566 (GRCm39) missense probably benign 0.15
R1337:Stk32a UTSW 18 43,394,414 (GRCm39) missense probably benign 0.00
R1559:Stk32a UTSW 18 43,376,149 (GRCm39) missense probably benign 0.32
R1695:Stk32a UTSW 18 43,446,485 (GRCm39) nonsense probably null
R1874:Stk32a UTSW 18 43,394,381 (GRCm39) missense probably damaging 1.00
R1954:Stk32a UTSW 18 43,345,090 (GRCm39) missense probably benign 0.45
R4529:Stk32a UTSW 18 43,376,044 (GRCm39) missense possibly damaging 0.83
R4980:Stk32a UTSW 18 43,447,113 (GRCm39) missense probably benign 0.01
R5124:Stk32a UTSW 18 43,438,082 (GRCm39) missense probably benign 0.00
R5751:Stk32a UTSW 18 43,438,085 (GRCm39) missense possibly damaging 0.74
R5822:Stk32a UTSW 18 43,446,552 (GRCm39) missense probably benign 0.00
R5863:Stk32a UTSW 18 43,448,209 (GRCm39) missense probably benign 0.00
R6167:Stk32a UTSW 18 43,446,474 (GRCm39) missense probably damaging 1.00
R6355:Stk32a UTSW 18 43,430,659 (GRCm39) splice site probably null
R6731:Stk32a UTSW 18 43,438,143 (GRCm39) missense probably damaging 1.00
R7162:Stk32a UTSW 18 43,430,649 (GRCm39) nonsense probably null
R8001:Stk32a UTSW 18 43,448,209 (GRCm39) missense possibly damaging 0.62
R8022:Stk32a UTSW 18 43,448,166 (GRCm39) nonsense probably null
R8485:Stk32a UTSW 18 43,376,075 (GRCm39) missense possibly damaging 0.83
R8994:Stk32a UTSW 18 43,443,542 (GRCm39) missense probably benign 0.03
R9097:Stk32a UTSW 18 43,446,497 (GRCm39) missense possibly damaging 0.62
R9183:Stk32a UTSW 18 43,394,405 (GRCm39) missense probably damaging 1.00
R9258:Stk32a UTSW 18 43,444,999 (GRCm39) missense probably benign 0.27
R9610:Stk32a UTSW 18 43,430,620 (GRCm39) missense probably benign
R9611:Stk32a UTSW 18 43,430,620 (GRCm39) missense probably benign
R9780:Stk32a UTSW 18 43,375,049 (GRCm39) missense probably benign 0.26
Predicted Primers PCR Primer
(F):5'- GTGTCAACTCCCCAGATCAAGACAG -3'
(R):5'- TGCATTCCATTCTGAAAGGAACCCG -3'

Sequencing Primer
(F):5'- TTCATTTGAGGCCCAATAGGACC -3'
(R):5'- tcacagatacatacacgcaaac -3'
Posted On 2013-04-16