Incidental Mutation 'R2383:Olfr38'
ID247603
Institutional Source Beutler Lab
Gene Symbol Olfr38
Ensembl Gene ENSMUSG00000095236
Gene Nameolfactory receptor 38
SynonymsMOR257-2, 18A, GA_x6K02T2P3E9-4797841-4796888
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.098) question?
Stock #R2383 (G1)
Quality Score225
Status Not validated
Chromosome6
Chromosomal Location42756404-42763231 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 42762459 bp
ZygosityHeterozygous
Amino Acid Change Methionine to Leucine at position 136 (M136L)
Ref Sequence ENSEMBL: ENSMUSP00000149726 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000074499] [ENSMUST00000215796]
Predicted Effect probably benign
Transcript: ENSMUST00000074499
AA Change: M136L

PolyPhen 2 Score 0.435 (Sensitivity: 0.89; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000093654
Gene: ENSMUSG00000095236
AA Change: M136L

DomainStartEndE-ValueType
Pfam:7tm_4 31 307 1.8e-52 PFAM
Pfam:7tm_1 41 290 5.4e-23 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000215796
AA Change: M136L

PolyPhen 2 Score 0.435 (Sensitivity: 0.89; Specificity: 0.90)
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.5%
  • 10x: 96.9%
  • 20x: 93.6%
Validation Efficiency
MGI Phenotype FUNCTION: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 23 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adam33 T C 2: 131,051,362 T748A probably benign Het
Afg3l2 A G 18: 67,422,956 V435A possibly damaging Het
BC005561 T C 5: 104,518,988 S459P probably benign Het
BC048403 A G 10: 121,750,649 T290A possibly damaging Het
Ccdc170 G A 10: 4,534,208 E345K probably benign Het
Chd2 T C 7: 73,503,420 I227V possibly damaging Het
Cndp2 C A 18: 84,675,090 D182Y possibly damaging Het
Col14a1 A T 15: 55,447,517 probably benign Het
Cyp2e1 C T 7: 140,770,068 S222L probably benign Het
Evx2 T C 2: 74,658,049 probably null Het
L1td1 A G 4: 98,737,722 E718G possibly damaging Het
Lgr4 T C 2: 110,000,615 S296P probably damaging Het
Lrrc7 T C 3: 158,163,956 M709V probably benign Het
Mtbp G A 15: 55,566,194 G162D probably damaging Het
Nap1l1 T G 10: 111,493,411 D295E probably damaging Het
Plrg1 C T 3: 83,065,948 P178S probably damaging Het
Serpina1b T A 12: 103,728,280 I402F probably benign Het
Sla T A 15: 66,782,676 I254F probably damaging Het
Slc25a29 A G 12: 108,827,008 S215P probably damaging Het
Tiam1 A G 16: 89,798,684 V1303A probably benign Het
Trim45 A T 3: 100,925,227 I259F probably damaging Het
Ttn T C 2: 76,706,512 S34990G probably benign Het
Zbtb48 A G 4: 152,026,950 V36A probably damaging Het
Other mutations in Olfr38
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01551:Olfr38 APN 6 42762112 missense probably damaging 0.99
IGL01567:Olfr38 APN 6 42762727 missense probably benign 0.07
IGL02097:Olfr38 APN 6 42762460 missense probably damaging 0.98
IGL02186:Olfr38 APN 6 42762946 missense probably null 0.96
IGL02473:Olfr38 APN 6 42762706 missense probably damaging 1.00
R0541:Olfr38 UTSW 6 42762220 missense probably damaging 1.00
R1210:Olfr38 UTSW 6 42762667 missense possibly damaging 0.79
R1368:Olfr38 UTSW 6 42762679 missense possibly damaging 0.91
R4614:Olfr38 UTSW 6 42762418 missense probably benign 0.07
R4616:Olfr38 UTSW 6 42762418 missense probably benign 0.07
R4844:Olfr38 UTSW 6 42762460 missense probably damaging 0.98
R5121:Olfr38 UTSW 6 42762997 nonsense probably null
R5951:Olfr38 UTSW 6 42762559 missense probably damaging 1.00
R6061:Olfr38 UTSW 6 42762965 missense probably damaging 0.99
R6336:Olfr38 UTSW 6 42762657 missense probably damaging 1.00
R7414:Olfr38 UTSW 6 42762828 missense probably damaging 1.00
X0018:Olfr38 UTSW 6 42762935 missense probably damaging 0.99
Z1177:Olfr38 UTSW 6 42762207 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- CCCTGGTGGATGCATCTTATG -3'
(R):5'- GACAATGCTAGAAACCATGATTGC -3'

Sequencing Primer
(F):5'- AAGCATAGTCCCCCAGCTG -3'
(R):5'- GCAATCTTGTTAGATGAGGTATCCAC -3'
Posted On2014-11-11