Incidental Mutation 'R2383:Cyp2e1'
ID 247605
Institutional Source Beutler Lab
Gene Symbol Cyp2e1
Ensembl Gene ENSMUSG00000025479
Gene Name cytochrome P450, family 2, subfamily e, polypeptide 1
Synonyms Cyp2e
Accession Numbers
Essential gene? Non essential (E-score: 0.000) question?
Stock # R2383 (G1)
Quality Score 225
Status Not validated
Chromosome 7
Chromosomal Location 140343732-140354903 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) C to T at 140349981 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Serine to Leucine at position 222 (S222L)
Ref Sequence ENSEMBL: ENSMUSP00000026552 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000026552] [ENSMUST00000209253] [ENSMUST00000210235]
AlphaFold Q05421
Predicted Effect probably benign
Transcript: ENSMUST00000026552
AA Change: S222L

PolyPhen 2 Score 0.057 (Sensitivity: 0.94; Specificity: 0.84)
SMART Domains Protein: ENSMUSP00000026552
Gene: ENSMUSG00000025479
AA Change: S222L

DomainStartEndE-ValueType
transmembrane domain 2 23 N/A INTRINSIC
Pfam:p450 33 489 1.4e-147 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000209253
Predicted Effect probably benign
Transcript: ENSMUST00000210235
Predicted Effect noncoding transcript
Transcript: ENSMUST00000210403
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.5%
  • 10x: 96.9%
  • 20x: 93.6%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the cytochrome P450 superfamily of enzymes. The cytochrome P450 proteins are monooxygenases which catalyze many reactions involved in drug metabolism and synthesis of cholesterol, steroids and other lipids. This protein localizes to the endoplasmic reticulum and is induced by ethanol, the diabetic state, and starvation. The enzyme metabolizes both endogenous substrates, such as ethanol, acetone, and acetal, as well as exogenous substrates including benzene, carbon tetrachloride, ethylene glycol, and nitrosamines which are premutagens found in cigarette smoke. Due to its many substrates, this enzyme may be involved in such varied processes as gluconeogenesis, hepatic cirrhosis, diabetes, and cancer. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a null allele exhibit altered responses to xenobiotics including decreased urethane-induced tumors and allylnitrile- or acetamenophen-associated mortality but increased allylnitrile-induced vestibular function loss. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 23 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adam33 T C 2: 130,893,282 (GRCm39) T748A probably benign Het
Afg3l2 A G 18: 67,556,026 (GRCm39) V435A possibly damaging Het
Ccdc170 G A 10: 4,484,208 (GRCm39) E345K probably benign Het
Chd2 T C 7: 73,153,168 (GRCm39) I227V possibly damaging Het
Cndp2 C A 18: 84,693,215 (GRCm39) D182Y possibly damaging Het
Col14a1 A T 15: 55,310,913 (GRCm39) probably benign Het
Evx2 T C 2: 74,488,393 (GRCm39) probably null Het
Kics2 A G 10: 121,586,554 (GRCm39) T290A possibly damaging Het
L1td1 A G 4: 98,625,959 (GRCm39) E718G possibly damaging Het
Lgr4 T C 2: 109,830,960 (GRCm39) S296P probably damaging Het
Lrrc7 T C 3: 157,869,593 (GRCm39) M709V probably benign Het
Mtbp G A 15: 55,429,590 (GRCm39) G162D probably damaging Het
Nap1l1 T G 10: 111,329,272 (GRCm39) D295E probably damaging Het
Or2f1b A T 6: 42,739,393 (GRCm39) M136L probably benign Het
Plrg1 C T 3: 82,973,255 (GRCm39) P178S probably damaging Het
Serpina1b T A 12: 103,694,539 (GRCm39) I402F probably benign Het
Sla T A 15: 66,654,525 (GRCm39) I254F probably damaging Het
Slc25a29 A G 12: 108,792,934 (GRCm39) S215P probably damaging Het
Thoc2l T C 5: 104,666,854 (GRCm39) S459P probably benign Het
Tiam1 A G 16: 89,595,572 (GRCm39) V1303A probably benign Het
Trim45 A T 3: 100,832,543 (GRCm39) I259F probably damaging Het
Ttn T C 2: 76,536,856 (GRCm39) S34990G probably benign Het
Zbtb48 A G 4: 152,111,407 (GRCm39) V36A probably damaging Het
Other mutations in Cyp2e1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00706:Cyp2e1 APN 7 140,349,066 (GRCm39) missense probably benign 0.17
IGL01755:Cyp2e1 APN 7 140,354,469 (GRCm39) critical splice acceptor site probably null
IGL01884:Cyp2e1 APN 7 140,353,663 (GRCm39) missense probably benign 0.16
IGL01950:Cyp2e1 APN 7 140,344,874 (GRCm39) critical splice donor site probably null
IGL01964:Cyp2e1 APN 7 140,343,779 (GRCm39) missense probably damaging 1.00
IGL02430:Cyp2e1 APN 7 140,350,139 (GRCm39) missense probably damaging 1.00
IGL02505:Cyp2e1 APN 7 140,349,069 (GRCm39) missense probably damaging 1.00
IGL02596:Cyp2e1 APN 7 140,350,031 (GRCm39) missense probably damaging 0.99
IGL02725:Cyp2e1 APN 7 140,343,828 (GRCm39) missense probably null 1.00
IGL02887:Cyp2e1 APN 7 140,343,824 (GRCm39) missense probably damaging 1.00
IGL03114:Cyp2e1 APN 7 140,353,042 (GRCm39) missense possibly damaging 0.95
IGL03146:Cyp2e1 APN 7 140,350,134 (GRCm39) missense probably benign 0.00
IGL03340:Cyp2e1 APN 7 140,344,767 (GRCm39) missense probably damaging 1.00
R1396:Cyp2e1 UTSW 7 140,352,992 (GRCm39) missense probably damaging 0.98
R2111:Cyp2e1 UTSW 7 140,353,547 (GRCm39) missense probably damaging 1.00
R2230:Cyp2e1 UTSW 7 140,344,827 (GRCm39) missense probably damaging 1.00
R2231:Cyp2e1 UTSW 7 140,344,827 (GRCm39) missense probably damaging 1.00
R3778:Cyp2e1 UTSW 7 140,343,822 (GRCm39) missense possibly damaging 0.58
R4082:Cyp2e1 UTSW 7 140,350,991 (GRCm39) missense possibly damaging 0.67
R4707:Cyp2e1 UTSW 7 140,343,821 (GRCm39) missense possibly damaging 0.58
R4751:Cyp2e1 UTSW 7 140,354,629 (GRCm39) nonsense probably null
R4784:Cyp2e1 UTSW 7 140,343,821 (GRCm39) missense possibly damaging 0.58
R4792:Cyp2e1 UTSW 7 140,353,588 (GRCm39) missense probably benign
R4917:Cyp2e1 UTSW 7 140,354,527 (GRCm39) missense possibly damaging 0.94
R4934:Cyp2e1 UTSW 7 140,350,030 (GRCm39) missense probably damaging 1.00
R5092:Cyp2e1 UTSW 7 140,354,648 (GRCm39) missense probably damaging 1.00
R5388:Cyp2e1 UTSW 7 140,343,906 (GRCm39) missense probably damaging 1.00
R5423:Cyp2e1 UTSW 7 140,350,031 (GRCm39) missense probably benign 0.01
R6740:Cyp2e1 UTSW 7 140,343,693 (GRCm39) unclassified probably benign
R7065:Cyp2e1 UTSW 7 140,343,906 (GRCm39) missense probably damaging 1.00
R7154:Cyp2e1 UTSW 7 140,350,050 (GRCm39) missense probably damaging 1.00
R8054:Cyp2e1 UTSW 7 140,350,871 (GRCm39) missense possibly damaging 0.80
R9130:Cyp2e1 UTSW 7 140,353,022 (GRCm39) missense probably damaging 0.99
Predicted Primers PCR Primer
(F):5'- AGGTTGGCTCAGCATCCTTC -3'
(R):5'- CGTCAGACTTGGATGATGCACC -3'

Sequencing Primer
(F):5'- ACTTCAGGATCCGTGTATACTTG -3'
(R):5'- TTGGATGATGCACCCCTGC -3'
Posted On 2014-11-11