Incidental Mutation 'R2383:Serpina1b'
ID247611
Institutional Source Beutler Lab
Gene Symbol Serpina1b
Ensembl Gene ENSMUSG00000071178
Gene Nameserine (or cysteine) preptidase inhibitor, clade A, member 1B
SynonymsPI2, D12Ucla2, Spi1-2
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.211) question?
Stock #R2383 (G1)
Quality Score225
Status Not validated
Chromosome12
Chromosomal Location103728156-103830373 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 103728280 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Phenylalanine at position 402 (I402F)
Ref Sequence ENSEMBL: ENSMUSP00000139941 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000095450] [ENSMUST00000164454] [ENSMUST00000186166] [ENSMUST00000187220]
Predicted Effect probably benign
Transcript: ENSMUST00000095450
AA Change: I402F

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000093101
Gene: ENSMUSG00000071178
AA Change: I402F

DomainStartEndE-ValueType
SERPIN 53 410 7.62e-203 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000164454
AA Change: I402F

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000127266
Gene: ENSMUSG00000071178
AA Change: I402F

DomainStartEndE-ValueType
SERPIN 53 410 7.62e-203 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000186166
AA Change: I402F

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000139941
Gene: ENSMUSG00000071178
AA Change: I402F

DomainStartEndE-ValueType
SERPIN 53 410 7.62e-203 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000187220
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.5%
  • 10x: 96.9%
  • 20x: 93.6%
Validation Efficiency
MGI Phenotype PHENOTYPE: Targeted disruption of this gene leads to significantly fewer than expected heterozygous and homozygous offspring from heterozygous matings. Homozygotes are healthy with no obvious changes in major organs while heterozygotes show a 30% decrease in serum anti-elastase and anti-chymotrypsin activity. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 23 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adam33 T C 2: 131,051,362 T748A probably benign Het
Afg3l2 A G 18: 67,422,956 V435A possibly damaging Het
BC005561 T C 5: 104,518,988 S459P probably benign Het
BC048403 A G 10: 121,750,649 T290A possibly damaging Het
Ccdc170 G A 10: 4,534,208 E345K probably benign Het
Chd2 T C 7: 73,503,420 I227V possibly damaging Het
Cndp2 C A 18: 84,675,090 D182Y possibly damaging Het
Col14a1 A T 15: 55,447,517 probably benign Het
Cyp2e1 C T 7: 140,770,068 S222L probably benign Het
Evx2 T C 2: 74,658,049 probably null Het
L1td1 A G 4: 98,737,722 E718G possibly damaging Het
Lgr4 T C 2: 110,000,615 S296P probably damaging Het
Lrrc7 T C 3: 158,163,956 M709V probably benign Het
Mtbp G A 15: 55,566,194 G162D probably damaging Het
Nap1l1 T G 10: 111,493,411 D295E probably damaging Het
Olfr38 A T 6: 42,762,459 M136L probably benign Het
Plrg1 C T 3: 83,065,948 P178S probably damaging Het
Sla T A 15: 66,782,676 I254F probably damaging Het
Slc25a29 A G 12: 108,827,008 S215P probably damaging Het
Tiam1 A G 16: 89,798,684 V1303A probably benign Het
Trim45 A T 3: 100,925,227 I259F probably damaging Het
Ttn T C 2: 76,706,512 S34990G probably benign Het
Zbtb48 A G 4: 152,026,950 V36A probably damaging Het
Other mutations in Serpina1b
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00544:Serpina1b APN 12 103729296 missense possibly damaging 0.90
IGL00990:Serpina1b APN 12 103728266 missense probably damaging 1.00
IGL01947:Serpina1b APN 12 103729317 missense probably benign 0.00
IGL03258:Serpina1b APN 12 103730396 missense probably benign 0.00
IGL03392:Serpina1b APN 12 103732070 missense possibly damaging 0.53
R1937:Serpina1b UTSW 12 103732161 missense probably benign 0.00
R3789:Serpina1b UTSW 12 103729272 missense probably damaging 1.00
R4690:Serpina1b UTSW 12 103732380 missense probably damaging 1.00
R5164:Serpina1b UTSW 12 103732087 missense probably benign 0.01
R5650:Serpina1b UTSW 12 103728435 critical splice acceptor site probably null
R6017:Serpina1b UTSW 12 103729272 missense probably damaging 1.00
R6241:Serpina1b UTSW 12 103729256 unclassified probably null
R6522:Serpina1b UTSW 12 103735037 unclassified probably null
R6745:Serpina1b UTSW 12 103730355 missense possibly damaging 0.60
R6884:Serpina1b UTSW 12 103732453 missense probably benign 0.00
R7053:Serpina1b UTSW 12 103732429 missense possibly damaging 0.93
R7208:Serpina1b UTSW 12 103728294 missense probably benign 0.04
R7679:Serpina1b UTSW 12 103730515 missense probably damaging 1.00
R7908:Serpina1b UTSW 12 103728307 missense possibly damaging 0.65
Predicted Primers PCR Primer
(F):5'- GGTCCACAACAAACTCAGGG -3'
(R):5'- AATCACTCTACCTGCAACTGG -3'

Sequencing Primer
(F):5'- GTCCACAACAAACTCAGGGCATAAAG -3'
(R):5'- TACCTGCAACTGGGCCTCTG -3'
Posted On2014-11-11