Incidental Mutation 'R2383:Slc25a29'
ID247612
Institutional Source Beutler Lab
Gene Symbol Slc25a29
Ensembl Gene ENSMUSG00000021265
Gene Namesolute carrier family 25 (mitochondrial carrier, palmitoylcarnitine transporter), member 29
SynonymsCACL, mCACL, C030003J19Rik
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R2383 (G1)
Quality Score225
Status Not validated
Chromosome12
Chromosomal Location108825873-108835883 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 108827008 bp
ZygosityHeterozygous
Amino Acid Change Serine to Proline at position 215 (S215P)
Ref Sequence ENSEMBL: ENSMUSP00000021693 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000021693]
Predicted Effect probably damaging
Transcript: ENSMUST00000021693
AA Change: S215P

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000021693
Gene: ENSMUSG00000021265
AA Change: S215P

DomainStartEndE-ValueType
Pfam:Mito_carr 1 91 1.5e-21 PFAM
Pfam:Mito_carr 88 182 4.6e-25 PFAM
Pfam:Mito_carr 185 279 1.8e-21 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000137023
Predicted Effect noncoding transcript
Transcript: ENSMUST00000139714
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.5%
  • 10x: 96.9%
  • 20x: 93.6%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a nuclear-encoded mitochondrial protein that is a member of the large family of solute carrier family 25 (SLC25) mitochondrial transporters. The members of this superfamily are involved in numerous metabolic pathways and cell functions. This gene product was previously reported to be a mitochondrial carnitine-acylcarnitine-like (CACL) translocase (PMID:128829710) or an ornithine transporter (designated ORNT3, PMID:19287344), however, a recent study characterized the main role of this protein as a mitochondrial transporter of basic amino acids, with a preference for arginine and lysine (PMID:24652292). Alternatively spliced transcript variants have been found for this gene. [provided by RefSeq, Apr 2014]
Allele List at MGI
Other mutations in this stock
Total: 23 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adam33 T C 2: 131,051,362 T748A probably benign Het
Afg3l2 A G 18: 67,422,956 V435A possibly damaging Het
BC005561 T C 5: 104,518,988 S459P probably benign Het
BC048403 A G 10: 121,750,649 T290A possibly damaging Het
Ccdc170 G A 10: 4,534,208 E345K probably benign Het
Chd2 T C 7: 73,503,420 I227V possibly damaging Het
Cndp2 C A 18: 84,675,090 D182Y possibly damaging Het
Col14a1 A T 15: 55,447,517 probably benign Het
Cyp2e1 C T 7: 140,770,068 S222L probably benign Het
Evx2 T C 2: 74,658,049 probably null Het
L1td1 A G 4: 98,737,722 E718G possibly damaging Het
Lgr4 T C 2: 110,000,615 S296P probably damaging Het
Lrrc7 T C 3: 158,163,956 M709V probably benign Het
Mtbp G A 15: 55,566,194 G162D probably damaging Het
Nap1l1 T G 10: 111,493,411 D295E probably damaging Het
Olfr38 A T 6: 42,762,459 M136L probably benign Het
Plrg1 C T 3: 83,065,948 P178S probably damaging Het
Serpina1b T A 12: 103,728,280 I402F probably benign Het
Sla T A 15: 66,782,676 I254F probably damaging Het
Tiam1 A G 16: 89,798,684 V1303A probably benign Het
Trim45 A T 3: 100,925,227 I259F probably damaging Het
Ttn T C 2: 76,706,512 S34990G probably benign Het
Zbtb48 A G 4: 152,026,950 V36A probably damaging Het
Other mutations in Slc25a29
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL03287:Slc25a29 APN 12 108831209 missense possibly damaging 0.49
R0116:Slc25a29 UTSW 12 108827091 missense possibly damaging 0.94
R1876:Slc25a29 UTSW 12 108827711 missense probably damaging 0.98
R2094:Slc25a29 UTSW 12 108827432 missense probably damaging 1.00
R2233:Slc25a29 UTSW 12 108835661 missense possibly damaging 0.92
R2276:Slc25a29 UTSW 12 108826926 missense probably benign 0.09
R2277:Slc25a29 UTSW 12 108826926 missense probably benign 0.09
R2279:Slc25a29 UTSW 12 108826926 missense probably benign 0.09
R4366:Slc25a29 UTSW 12 108831171 intron probably benign
R7859:Slc25a29 UTSW 12 108826830 missense probably benign 0.01
Predicted Primers PCR Primer
(F):5'- TGCCTCACTGTCTACCTGAG -3'
(R):5'- ATGGTGTCCACACTTCTGCG -3'

Sequencing Primer
(F):5'- TCGCCCCGGGTATATGTAAG -3'
(R):5'- TCCACACTTCTGCGGGAGAC -3'
Posted On2014-11-11