Incidental Mutation 'R2383:Sla'
ID247617
Institutional Source Beutler Lab
Gene Symbol Sla
Ensembl Gene ENSMUSG00000022372
Gene Namesrc-like adaptor
SynonymsSlap, Slap-1
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R2383 (G1)
Quality Score225
Status Not validated
Chromosome15
Chromosomal Location66780819-66831829 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 66782676 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Phenylalanine at position 254 (I254F)
Ref Sequence ENSEMBL: ENSMUSP00000131865 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000065916] [ENSMUST00000100572] [ENSMUST00000163495] [ENSMUST00000164163] [ENSMUST00000168522] [ENSMUST00000168589] [ENSMUST00000171045]
Predicted Effect probably benign
Transcript: ENSMUST00000065916
SMART Domains Protein: ENSMUSP00000070239
Gene: ENSMUSG00000053469

DomainStartEndE-ValueType
signal peptide 1 20 N/A INTRINSIC
TY 50 97 5.9e-16 SMART
TY 118 165 5.59e-17 SMART
Pfam:Thyroglobulin_1 174 252 4e-9 PFAM
TY 317 363 4.36e-19 SMART
low complexity region 495 504 N/A INTRINSIC
TY 617 662 3.58e-15 SMART
TY 684 730 1.47e-16 SMART
TY 880 926 1.51e-4 SMART
TY 1029 1078 1.21e-12 SMART
TY 1106 1150 7.56e-5 SMART
TY 1167 1215 7.26e-16 SMART
low complexity region 1244 1255 N/A INTRINSIC
Pfam:GCC2_GCC3 1464 1509 2.7e-16 PFAM
TY 1519 1568 9.81e-13 SMART
Pfam:COesterase 2181 2717 8.4e-140 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000100572
AA Change: I238F

PolyPhen 2 Score 0.997 (Sensitivity: 0.41; Specificity: 0.98)
SMART Domains Protein: ENSMUSP00000098138
Gene: ENSMUSG00000022372
AA Change: I238F

DomainStartEndE-ValueType
low complexity region 7 24 N/A INTRINSIC
SH3 25 81 2.5e-6 SMART
SH2 82 166 4.1e-31 SMART
low complexity region 247 260 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000163495
SMART Domains Protein: ENSMUSP00000129868
Gene: ENSMUSG00000053469

DomainStartEndE-ValueType
TY 14 63 1.21e-12 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000164163
AA Change: I238F

PolyPhen 2 Score 0.997 (Sensitivity: 0.41; Specificity: 0.98)
SMART Domains Protein: ENSMUSP00000127901
Gene: ENSMUSG00000022372
AA Change: I238F

DomainStartEndE-ValueType
low complexity region 7 24 N/A INTRINSIC
SH3 25 81 2.5e-6 SMART
SH2 82 166 4.1e-31 SMART
low complexity region 247 260 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000164939
Predicted Effect probably damaging
Transcript: ENSMUST00000168522
AA Change: I254F

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000131865
Gene: ENSMUSG00000022372
AA Change: I254F

DomainStartEndE-ValueType
low complexity region 23 40 N/A INTRINSIC
SH3 41 97 4.1e-4 SMART
SH2 98 182 6.67e-29 SMART
low complexity region 263 276 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000168589
AA Change: I238F

PolyPhen 2 Score 0.997 (Sensitivity: 0.41; Specificity: 0.98)
SMART Domains Protein: ENSMUSP00000130222
Gene: ENSMUSG00000022372
AA Change: I238F

DomainStartEndE-ValueType
low complexity region 7 24 N/A INTRINSIC
SH3 25 81 2.5e-6 SMART
SH2 82 166 4.1e-31 SMART
low complexity region 247 260 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000171045
SMART Domains Protein: ENSMUSP00000126454
Gene: ENSMUSG00000053469

DomainStartEndE-ValueType
internal_repeat_1 93 331 1.53e-6 PROSPERO
Pfam:COesterase 562 1098 2.1e-137 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000172153
SMART Domains Protein: ENSMUSP00000128410
Gene: ENSMUSG00000053469

DomainStartEndE-ValueType
Pfam:COesterase 313 849 6e-140 PFAM
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.5%
  • 10x: 96.9%
  • 20x: 93.6%
Validation Efficiency
MGI Phenotype PHENOTYPE: Homozygous inactivation in this locus affects T cell development. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 23 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adam33 T C 2: 131,051,362 T748A probably benign Het
Afg3l2 A G 18: 67,422,956 V435A possibly damaging Het
BC005561 T C 5: 104,518,988 S459P probably benign Het
BC048403 A G 10: 121,750,649 T290A possibly damaging Het
Ccdc170 G A 10: 4,534,208 E345K probably benign Het
Chd2 T C 7: 73,503,420 I227V possibly damaging Het
Cndp2 C A 18: 84,675,090 D182Y possibly damaging Het
Col14a1 A T 15: 55,447,517 probably benign Het
Cyp2e1 C T 7: 140,770,068 S222L probably benign Het
Evx2 T C 2: 74,658,049 probably null Het
L1td1 A G 4: 98,737,722 E718G possibly damaging Het
Lgr4 T C 2: 110,000,615 S296P probably damaging Het
Lrrc7 T C 3: 158,163,956 M709V probably benign Het
Mtbp G A 15: 55,566,194 G162D probably damaging Het
Nap1l1 T G 10: 111,493,411 D295E probably damaging Het
Olfr38 A T 6: 42,762,459 M136L probably benign Het
Plrg1 C T 3: 83,065,948 P178S probably damaging Het
Serpina1b T A 12: 103,728,280 I402F probably benign Het
Slc25a29 A G 12: 108,827,008 S215P probably damaging Het
Tiam1 A G 16: 89,798,684 V1303A probably benign Het
Trim45 A T 3: 100,925,227 I259F probably damaging Het
Ttn T C 2: 76,706,512 S34990G probably benign Het
Zbtb48 A G 4: 152,026,950 V36A probably damaging Het
Other mutations in Sla
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00225:Sla APN 15 66782630 missense possibly damaging 0.59
IGL03180:Sla APN 15 66789720 missense probably benign 0.01
crimson UTSW 15 66793705 missense probably damaging 1.00
Hearst UTSW 15 66787090 missense probably damaging 1.00
R0497:Sla UTSW 15 66792249 missense probably benign 0.00
R2019:Sla UTSW 15 66782555 missense probably damaging 1.00
R2135:Sla UTSW 15 66782714 missense probably benign 0.30
R3442:Sla UTSW 15 66783660 missense probably benign 0.00
R4495:Sla UTSW 15 66801512 missense probably benign
R5851:Sla UTSW 15 66783723 missense probably damaging 0.98
R5935:Sla UTSW 15 66793705 missense probably damaging 1.00
R6161:Sla UTSW 15 66782598 missense probably null 0.03
R6837:Sla UTSW 15 66787090 missense probably damaging 1.00
R7196:Sla UTSW 15 66831571 missense probably benign 0.00
RF022:Sla UTSW 15 66782744 missense probably benign
Predicted Primers PCR Primer
(F):5'- TAAGACCCCAGGTGACAGTC -3'
(R):5'- GCCCACCATTGCAAGAAATG -3'

Sequencing Primer
(F):5'- CCAGGTGACAGTCAAAGCCTTTG -3'
(R):5'- GCTACAAAAATCTAACCTCCTTTCC -3'
Posted On2014-11-11