Incidental Mutation 'R2383:Cndp2'
ID247621
Institutional Source Beutler Lab
Gene Symbol Cndp2
Ensembl Gene ENSMUSG00000024644
Gene NameCNDP dipeptidase 2 (metallopeptidase M20 family)
SynonymsPep1, Dip-2, 0610010E05Rik, Cn2, Pep-1
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R2383 (G1)
Quality Score225
Status Not validated
Chromosome18
Chromosomal Location84667470-84685633 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to A at 84675090 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Tyrosine at position 182 (D182Y)
Ref Sequence ENSEMBL: ENSMUSP00000128696 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000025546] [ENSMUST00000168419]
Predicted Effect possibly damaging
Transcript: ENSMUST00000025546
AA Change: D182Y

PolyPhen 2 Score 0.650 (Sensitivity: 0.87; Specificity: 0.91)
SMART Domains Protein: ENSMUSP00000025546
Gene: ENSMUSG00000024644
AA Change: D182Y

DomainStartEndE-ValueType
low complexity region 75 82 N/A INTRINSIC
Pfam:Peptidase_M20 95 469 6.8e-35 PFAM
Pfam:M20_dimer 208 369 2.1e-15 PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000168419
AA Change: D182Y

PolyPhen 2 Score 0.819 (Sensitivity: 0.84; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000128696
Gene: ENSMUSG00000024644
AA Change: D182Y

DomainStartEndE-ValueType
low complexity region 75 82 N/A INTRINSIC
Pfam:Peptidase_M20 95 469 6.2e-33 PFAM
Pfam:M20_dimer 208 369 2.1e-15 PFAM
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.5%
  • 10x: 96.9%
  • 20x: 93.6%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] CNDP2, also known as tissue carnosinase and peptidase A (EC 3.4.13.18), is a nonspecific dipeptidase rather than a selective carnosinase (Teufel et al., 2003 [PubMed 12473676]).[supplied by OMIM, Mar 2008]
Allele List at MGI
Other mutations in this stock
Total: 23 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adam33 T C 2: 131,051,362 T748A probably benign Het
Afg3l2 A G 18: 67,422,956 V435A possibly damaging Het
BC005561 T C 5: 104,518,988 S459P probably benign Het
BC048403 A G 10: 121,750,649 T290A possibly damaging Het
Ccdc170 G A 10: 4,534,208 E345K probably benign Het
Chd2 T C 7: 73,503,420 I227V possibly damaging Het
Col14a1 A T 15: 55,447,517 probably benign Het
Cyp2e1 C T 7: 140,770,068 S222L probably benign Het
Evx2 T C 2: 74,658,049 probably null Het
L1td1 A G 4: 98,737,722 E718G possibly damaging Het
Lgr4 T C 2: 110,000,615 S296P probably damaging Het
Lrrc7 T C 3: 158,163,956 M709V probably benign Het
Mtbp G A 15: 55,566,194 G162D probably damaging Het
Nap1l1 T G 10: 111,493,411 D295E probably damaging Het
Olfr38 A T 6: 42,762,459 M136L probably benign Het
Plrg1 C T 3: 83,065,948 P178S probably damaging Het
Serpina1b T A 12: 103,728,280 I402F probably benign Het
Sla T A 15: 66,782,676 I254F probably damaging Het
Slc25a29 A G 12: 108,827,008 S215P probably damaging Het
Tiam1 A G 16: 89,798,684 V1303A probably benign Het
Trim45 A T 3: 100,925,227 I259F probably damaging Het
Ttn T C 2: 76,706,512 S34990G probably benign Het
Zbtb48 A G 4: 152,026,950 V36A probably damaging Het
Other mutations in Cndp2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00899:Cndp2 APN 18 84677376 missense probably damaging 1.00
IGL01143:Cndp2 APN 18 84677317 critical splice donor site probably null
IGL01310:Cndp2 APN 18 84670877 missense possibly damaging 0.95
IGL01408:Cndp2 APN 18 84670911 missense probably benign
IGL01520:Cndp2 APN 18 84668607 missense probably benign 0.03
IGL02095:Cndp2 APN 18 84681032 missense possibly damaging 0.67
R1108:Cndp2 UTSW 18 84675060 missense probably damaging 1.00
R1264:Cndp2 UTSW 18 84678791 missense possibly damaging 0.88
R1466:Cndp2 UTSW 18 84677315 splice site probably benign
R1584:Cndp2 UTSW 18 84677315 splice site probably benign
R2363:Cndp2 UTSW 18 84668569 missense probably damaging 0.96
R3153:Cndp2 UTSW 18 84668597 missense probably benign 0.02
R4590:Cndp2 UTSW 18 84669808 missense probably damaging 1.00
R4788:Cndp2 UTSW 18 84675164 missense probably damaging 1.00
R5033:Cndp2 UTSW 18 84670829 missense possibly damaging 0.94
R5154:Cndp2 UTSW 18 84668602 missense probably benign 0.00
R5178:Cndp2 UTSW 18 84675028 missense probably benign 0.00
R5326:Cndp2 UTSW 18 84672076 missense probably damaging 1.00
R5542:Cndp2 UTSW 18 84672076 missense probably damaging 1.00
R5556:Cndp2 UTSW 18 84672124 missense probably benign 0.38
R5722:Cndp2 UTSW 18 84668078 nonsense probably null
R6431:Cndp2 UTSW 18 84675078 nonsense probably null
R6682:Cndp2 UTSW 18 84677330 missense probably benign 0.00
R7036:Cndp2 UTSW 18 84669945 missense possibly damaging 0.94
R7728:Cndp2 UTSW 18 84672077 missense probably benign 0.00
R7806:Cndp2 UTSW 18 84670820 missense probably benign
R8018:Cndp2 UTSW 18 84668602 missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- GAGCTTCATGCATGGTTAGC -3'
(R):5'- AGCCAGTGGGAGAAGATCTC -3'

Sequencing Primer
(F):5'- GTATTTGCCCCGGTCAGG -3'
(R):5'- AACCATGTCTTACCACGC -3'
Posted On2014-11-11