Incidental Mutation 'R2384:Hdac4'
ID247627
Institutional Source Beutler Lab
Gene Symbol Hdac4
Ensembl Gene ENSMUSG00000026313
Gene Namehistone deacetylase 4
Synonyms4932408F19Rik
MMRRC Submission 040358-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R2384 (G1)
Quality Score225
Status Validated
Chromosome1
Chromosomal Location91928779-92195699 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 91984485 bp
ZygosityHeterozygous
Amino Acid Change Tyrosine to Cysteine at position 394 (Y394C)
Ref Sequence ENSEMBL: ENSMUSP00000095249 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000008995] [ENSMUST00000097644]
Predicted Effect probably benign
Transcript: ENSMUST00000008995
AA Change: Y394C

PolyPhen 2 Score 0.017 (Sensitivity: 0.95; Specificity: 0.80)
SMART Domains Protein: ENSMUSP00000008995
Gene: ENSMUSG00000026313
AA Change: Y394C

DomainStartEndE-ValueType
Pfam:HDAC4_Gln 61 151 5e-38 PFAM
low complexity region 289 310 N/A INTRINSIC
low complexity region 354 368 N/A INTRINSIC
low complexity region 472 502 N/A INTRINSIC
low complexity region 517 529 N/A INTRINSIC
low complexity region 558 575 N/A INTRINSIC
Pfam:Hist_deacetyl 661 985 1.4e-85 PFAM
low complexity region 1066 1075 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000097644
AA Change: Y394C

PolyPhen 2 Score 0.017 (Sensitivity: 0.95; Specificity: 0.80)
Predicted Effect noncoding transcript
Transcript: ENSMUST00000181260
Predicted Effect noncoding transcript
Transcript: ENSMUST00000189303
Predicted Effect noncoding transcript
Transcript: ENSMUST00000189730
Predicted Effect noncoding transcript
Transcript: ENSMUST00000194827
Meta Mutation Damage Score 0.1493 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.4%
  • 10x: 96.6%
  • 20x: 92.5%
Validation Efficiency 100% (37/37)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Histones play a critical role in transcriptional regulation, cell cycle progression, and developmental events. Histone acetylation/deacetylation alters chromosome structure and affects transcription factor access to DNA. The protein encoded by this gene belongs to class II of the histone deacetylase/acuc/apha family. It possesses histone deacetylase activity and represses transcription when tethered to a promoter. This protein does not bind DNA directly, but through transcription factors MEF2C and MEF2D. It seems to interact in a multiprotein complex with RbAp48 and HDAC3. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a gene trap allele exhibit increased thermal nociception threshold and seizures. Mice homozygous for a knock-out allele exhibit postnatal lethality, exencephaly, and abnormal skeleton morphology and physiology. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 35 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2700049A03Rik G T 12: 71,164,546 E685* probably null Het
2700049A03Rik A T 12: 71,164,547 E685V possibly damaging Het
4933414I15Rik A G 11: 50,942,506 S90P unknown Het
Abca13 T C 11: 9,267,450 probably benign Het
Chpf C T 1: 75,475,109 R567H probably benign Het
Cnp A G 11: 100,576,453 Y74C probably damaging Het
Cul3 A T 1: 80,283,689 V273D probably damaging Het
Dnmt3a A G 12: 3,901,591 Y656C probably damaging Het
Erich3 A T 3: 154,764,651 E107V possibly damaging Het
Fscn2 T C 11: 120,366,733 S307P possibly damaging Het
Gm156 T A 6: 129,772,380 H84L probably benign Het
Grm5 A G 7: 87,602,728 E62G probably damaging Het
Hipk2 A G 6: 38,818,371 I314T probably damaging Het
Hsd17b12 T A 2: 94,033,619 I293L probably benign Het
Il1f9 A G 2: 24,192,648 H145R probably benign Het
Ints12 T A 3: 133,109,103 probably null Het
Khdrbs2 T C 1: 32,519,895 S369G probably damaging Het
Mup5 T A 4: 61,835,024 probably null Het
Nlrp4g A G 9: 124,349,707 noncoding transcript Het
Obscn A G 11: 59,042,837 probably null Het
Ogdh C A 11: 6,342,526 A413D probably damaging Het
Podn T C 4: 108,022,072 E283G probably damaging Het
Ppp1r32 A C 19: 10,481,282 probably null Het
Ripk1 A G 13: 34,030,043 D456G probably benign Het
Scg3 T C 9: 75,665,726 T308A probably damaging Het
Sele A G 1: 164,050,775 T228A probably benign Het
Slc41a3 A G 6: 90,626,411 E138G probably damaging Het
Tmem161a T C 8: 70,177,554 V104A probably benign Het
Tmem232 G A 17: 65,402,857 R479W probably damaging Het
Trim26 C T 17: 36,850,889 P67S probably damaging Het
Trpm8 A G 1: 88,359,656 Y787C probably benign Het
Ttc28 T A 5: 111,276,208 V1447D possibly damaging Het
Uaca G A 9: 60,869,917 A527T probably damaging Het
Ucp2 A G 7: 100,498,254 I172V probably benign Het
Zzef1 T A 11: 72,858,394 Y903N probably damaging Het
Other mutations in Hdac4
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01324:Hdac4 APN 1 91959415 missense probably damaging 0.99
IGL01396:Hdac4 APN 1 91959474 splice site probably benign
IGL01536:Hdac4 APN 1 91930146 utr 3 prime probably benign
IGL01860:Hdac4 APN 1 91933695 missense probably benign 0.31
IGL02110:Hdac4 APN 1 91984405 missense probably benign 0.00
IGL02201:Hdac4 APN 1 91987660 splice site probably null
IGL02294:Hdac4 APN 1 91982207 missense probably benign
IGL02367:Hdac4 APN 1 91958449 splice site probably benign
IGL02429:Hdac4 APN 1 92012695 missense probably benign 0.00
IGL02966:Hdac4 APN 1 92054945 missense possibly damaging 0.94
IGL03250:Hdac4 APN 1 91934600 critical splice donor site probably null
R0067:Hdac4 UTSW 1 92029984 missense probably damaging 1.00
R0103:Hdac4 UTSW 1 91975644 missense possibly damaging 0.73
R0288:Hdac4 UTSW 1 91971006 missense probably damaging 1.00
R0334:Hdac4 UTSW 1 91956038 splice site probably benign
R1473:Hdac4 UTSW 1 92029968 missense possibly damaging 0.88
R1732:Hdac4 UTSW 1 91947535 missense probably benign 0.01
R1826:Hdac4 UTSW 1 91984699 missense probably damaging 1.00
R1987:Hdac4 UTSW 1 91934645 missense probably damaging 1.00
R2189:Hdac4 UTSW 1 91975522 missense probably null 0.00
R3705:Hdac4 UTSW 1 91934694 splice site probably benign
R3894:Hdac4 UTSW 1 91970968 missense possibly damaging 0.95
R4440:Hdac4 UTSW 1 91945995 missense probably damaging 1.00
R5075:Hdac4 UTSW 1 91996120 missense probably benign 0.00
R5431:Hdac4 UTSW 1 91972790 nonsense probably null
R5505:Hdac4 UTSW 1 91975465 missense probably benign
R5854:Hdac4 UTSW 1 91959421 missense probably damaging 1.00
R6018:Hdac4 UTSW 1 91958398 missense probably damaging 1.00
R6164:Hdac4 UTSW 1 92030154 missense probably benign 0.04
R6239:Hdac4 UTSW 1 92054972 missense probably benign 0.17
R6247:Hdac4 UTSW 1 92012838 splice site probably null
R6306:Hdac4 UTSW 1 91996174 missense probably benign 0.00
R6381:Hdac4 UTSW 1 91984525 missense possibly damaging 0.67
R6450:Hdac4 UTSW 1 91984711 missense possibly damaging 0.81
R6504:Hdac4 UTSW 1 91968455 missense possibly damaging 0.88
R6639:Hdac4 UTSW 1 91970948 missense probably damaging 1.00
R6799:Hdac4 UTSW 1 92002213 missense probably damaging 0.98
R6910:Hdac4 UTSW 1 91982153 missense probably damaging 1.00
R7002:Hdac4 UTSW 1 91968361 missense possibly damaging 0.85
R7781:Hdac4 UTSW 1 91975665 missense probably benign 0.41
R7966:Hdac4 UTSW 1 91933680 missense possibly damaging 0.71
R8156:Hdac4 UTSW 1 91958416 missense probably damaging 0.99
Z1177:Hdac4 UTSW 1 91956047 missense probably damaging 1.00
Z1177:Hdac4 UTSW 1 91987611 missense probably damaging 0.96
Predicted Primers PCR Primer
(F):5'- GGGCTCAGTTGTTCTTTCCAGC -3'
(R):5'- ATCACCTTGGGACTTCCTGC -3'

Sequencing Primer
(F):5'- GCCTTCTTTAAAAGCTACAGGAGGC -3'
(R):5'- TTGGGACTTCCTGCCACTGG -3'
Posted On2014-11-11