Incidental Mutation 'R2384:Hsd17b12'
ID247630
Institutional Source Beutler Lab
Gene Symbol Hsd17b12
Ensembl Gene ENSMUSG00000027195
Gene Namehydroxysteroid (17-beta) dehydrogenase 12
Synonymskeratonectin, keratoadhesin, 2610510O05Rik, KIK-I
MMRRC Submission 040358-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R2384 (G1)
Quality Score225
Status Validated
Chromosome2
Chromosomal Location94032689-94157964 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 94033619 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Leucine at position 293 (I293L)
Ref Sequence ENSEMBL: ENSMUSP00000028619 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000028619]
Predicted Effect probably benign
Transcript: ENSMUST00000028619
AA Change: I293L

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000028619
Gene: ENSMUSG00000027195
AA Change: I293L

DomainStartEndE-ValueType
transmembrane domain 7 24 N/A INTRINSIC
Pfam:adh_short 51 248 1.5e-46 PFAM
Pfam:KR 52 125 4.4e-7 PFAM
Pfam:adh_short_C2 57 277 7.5e-10 PFAM
low complexity region 298 312 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000127084
Predicted Effect noncoding transcript
Transcript: ENSMUST00000145967
Predicted Effect noncoding transcript
Transcript: ENSMUST00000146580
Meta Mutation Damage Score 0.0624 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.4%
  • 10x: 96.6%
  • 20x: 92.5%
Validation Efficiency 100% (37/37)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a very important 17beta-hydroxysteroid dehydrogenase (17beta-HSD) that converts estrone into estradiol in ovarian tissue. This enzyme is also involved in fatty acid elongation. [provided by RefSeq, Oct 2011]
PHENOTYPE: Mice homozygous for a gene trap allele exhibit die around E8.5 with abnormal embryonic and extraembryonic tissue development. ES cells heterozygous for this allele exhibit reduced arachidonic acid levels. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 35 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2700049A03Rik G T 12: 71,164,546 E685* probably null Het
2700049A03Rik A T 12: 71,164,547 E685V possibly damaging Het
4933414I15Rik A G 11: 50,942,506 S90P unknown Het
Abca13 T C 11: 9,267,450 probably benign Het
Chpf C T 1: 75,475,109 R567H probably benign Het
Cnp A G 11: 100,576,453 Y74C probably damaging Het
Cul3 A T 1: 80,283,689 V273D probably damaging Het
Dnmt3a A G 12: 3,901,591 Y656C probably damaging Het
Erich3 A T 3: 154,764,651 E107V possibly damaging Het
Fscn2 T C 11: 120,366,733 S307P possibly damaging Het
Gm156 T A 6: 129,772,380 H84L probably benign Het
Grm5 A G 7: 87,602,728 E62G probably damaging Het
Hdac4 T C 1: 91,984,485 Y394C probably benign Het
Hipk2 A G 6: 38,818,371 I314T probably damaging Het
Il1f9 A G 2: 24,192,648 H145R probably benign Het
Ints12 T A 3: 133,109,103 probably null Het
Khdrbs2 T C 1: 32,519,895 S369G probably damaging Het
Mup5 T A 4: 61,835,024 probably null Het
Nlrp4g A G 9: 124,349,707 noncoding transcript Het
Obscn A G 11: 59,042,837 probably null Het
Ogdh C A 11: 6,342,526 A413D probably damaging Het
Podn T C 4: 108,022,072 E283G probably damaging Het
Ppp1r32 A C 19: 10,481,282 probably null Het
Ripk1 A G 13: 34,030,043 D456G probably benign Het
Scg3 T C 9: 75,665,726 T308A probably damaging Het
Sele A G 1: 164,050,775 T228A probably benign Het
Slc41a3 A G 6: 90,626,411 E138G probably damaging Het
Tmem161a T C 8: 70,177,554 V104A probably benign Het
Tmem232 G A 17: 65,402,857 R479W probably damaging Het
Trim26 C T 17: 36,850,889 P67S probably damaging Het
Trpm8 A G 1: 88,359,656 Y787C probably benign Het
Ttc28 T A 5: 111,276,208 V1447D possibly damaging Het
Uaca G A 9: 60,869,917 A527T probably damaging Het
Ucp2 A G 7: 100,498,254 I172V probably benign Het
Zzef1 T A 11: 72,858,394 Y903N probably damaging Het
Other mutations in Hsd17b12
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00498:Hsd17b12 APN 2 94083165 critical splice donor site probably null
IGL00785:Hsd17b12 APN 2 94045414 missense probably damaging 1.00
IGL02230:Hsd17b12 APN 2 94045398 missense possibly damaging 0.94
IGL02635:Hsd17b12 APN 2 94083211 missense possibly damaging 0.93
IGL03094:Hsd17b12 APN 2 94033994 missense probably damaging 1.00
R0242:Hsd17b12 UTSW 2 94157815 missense probably benign 0.14
R0242:Hsd17b12 UTSW 2 94157815 missense probably benign 0.14
R0390:Hsd17b12 UTSW 2 94114990 splice site probably benign
R0552:Hsd17b12 UTSW 2 94043935 missense probably damaging 1.00
R0605:Hsd17b12 UTSW 2 94033642 missense probably benign 0.00
R1585:Hsd17b12 UTSW 2 94033976 missense probably damaging 1.00
R1681:Hsd17b12 UTSW 2 94033561 missense unknown
R1922:Hsd17b12 UTSW 2 94045392 missense probably benign 0.00
R2190:Hsd17b12 UTSW 2 94034063 missense probably benign 0.02
R3123:Hsd17b12 UTSW 2 94033958 missense probably benign 0.03
R3124:Hsd17b12 UTSW 2 94033958 missense probably benign 0.03
R3125:Hsd17b12 UTSW 2 94033958 missense probably benign 0.03
R4283:Hsd17b12 UTSW 2 94033586 missense unknown
R5218:Hsd17b12 UTSW 2 94083263 missense probably benign 0.02
R5357:Hsd17b12 UTSW 2 94033645 missense possibly damaging 0.47
R6020:Hsd17b12 UTSW 2 94033977 missense probably damaging 1.00
R6493:Hsd17b12 UTSW 2 94043883 missense probably damaging 1.00
R7792:Hsd17b12 UTSW 2 94033641 missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- TCTGCCAACTATGCCATGTTAG -3'
(R):5'- TGATCCACTCTCTCATGGTATGTAC -3'

Sequencing Primer
(F):5'- GCCAACTATGCCATGTTAGTAATTAC -3'
(R):5'- CTTAAACATATTTTCCAGTTTGGGC -3'
Posted On2014-11-11