Mutagenetix > Incidental Mutations

Incidental Mutation 'R2384:Uaca'

247644

Institutional Source

Beutler Lab

Gene Symbol

Uaca

Ensembl Gene

ENSMUSG00000034485

Gene Name

uveal autoantigen with coiled-coil domains and ankyrin repeats

Synonyms

2700059D02Rik, nucling

MMRRC Submission

040358-MU

Accession Numbers

Is this an essential gene?

Probably non essential (E-score: 0.133) question?

Stock #

R2384 (G1)

Quality Score

225

Status

Validated

Chromosome

Chromosomal Location

60794542-60880370 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

G to A at 60869917 bp

Zygosity

Heterozygous

Amino Acid Change

Alanine to Threonine at position 527 (A527T)

Ref Sequence

ENSEMBL: ENSMUSP00000151172 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000050183] [ENSMUST00000214354]

Predicted Effect

probably damaging
Transcript: ENSMUST00000050183
AA Change: A529T

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

SMART Domains

Protein: ENSMUSP00000062047
Gene: ENSMUSG00000034485
AA Change: A529T

Domain	Start	End	E-Value	Type
low complexity region	13	31	N/A	INTRINSIC
ANK	35	68	2.66e3	SMART
ANK	69	98	1.96e-3	SMART
ANK	102	131	1.65e-1	SMART
ANK	135	164	1.38e-3	SMART
ANK	168	197	3.65e-3	SMART
ANK	201	230	6.26e-2	SMART
Blast:ANK	234	263	7e-9	BLAST
coiled coil region	301	381	N/A	INTRINSIC
coiled coil region	445	626	N/A	INTRINSIC
Pfam:TolA_bind_tri	869	943	4e-11	PFAM
coiled coil region	1009	1382	N/A	INTRINSIC

Predicted Effect

probably damaging
Transcript: ENSMUST00000214354
AA Change: A527T

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000214997

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000216574

Predicted Effect

unknown
Transcript: ENSMUST00000217656
AA Change: A521T

Meta Mutation Damage Score

0.1923

Coding Region Coverage

1x: 99.1%
3x: 98.4%
10x: 96.6%
20x: 92.5%

Validation Efficiency

100% (37/37)

MGI Phenotype

PHENOTYPE: Homozygous mice display swelling of and inflammatory lesions in the preputial gland. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 35 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
2700049A03Rik	G	T	12: 71,164,546	E685*	probably null	Het
2700049A03Rik	A	T	12: 71,164,547	E685V	possibly damaging	Het
4933414I15Rik	A	G	11: 50,942,506	S90P	unknown	Het
Abca13	T	C	11: 9,267,450		probably benign	Het
Chpf	C	T	1: 75,475,109	R567H	probably benign	Het
Cnp	A	G	11: 100,576,453	Y74C	probably damaging	Het
Cul3	A	T	1: 80,283,689	V273D	probably damaging	Het
Dnmt3a	A	G	12: 3,901,591	Y656C	probably damaging	Het
Erich3	A	T	3: 154,764,651	E107V	possibly damaging	Het
Fscn2	T	C	11: 120,366,733	S307P	possibly damaging	Het
Gm156	T	A	6: 129,772,380	H84L	probably benign	Het
Grm5	A	G	7: 87,602,728	E62G	probably damaging	Het
Hdac4	T	C	1: 91,984,485	Y394C	probably benign	Het
Hipk2	A	G	6: 38,818,371	I314T	probably damaging	Het
Hsd17b12	T	A	2: 94,033,619	I293L	probably benign	Het
Il1f9	A	G	2: 24,192,648	H145R	probably benign	Het
Ints12	T	A	3: 133,109,103		probably null	Het
Khdrbs2	T	C	1: 32,519,895	S369G	probably damaging	Het
Mup5	T	A	4: 61,835,024		probably null	Het
Nlrp4g	A	G	9: 124,349,707		noncoding transcript	Het
Obscn	A	G	11: 59,042,837		probably null	Het
Ogdh	C	A	11: 6,342,526	A413D	probably damaging	Het
Podn	T	C	4: 108,022,072	E283G	probably damaging	Het
Ppp1r32	A	C	19: 10,481,282		probably null	Het
Ripk1	A	G	13: 34,030,043	D456G	probably benign	Het
Scg3	T	C	9: 75,665,726	T308A	probably damaging	Het
Sele	A	G	1: 164,050,775	T228A	probably benign	Het
Slc41a3	A	G	6: 90,626,411	E138G	probably damaging	Het
Tmem161a	T	C	8: 70,177,554	V104A	probably benign	Het
Tmem232	G	A	17: 65,402,857	R479W	probably damaging	Het
Trim26	C	T	17: 36,850,889	P67S	probably damaging	Het
Trpm8	A	G	1: 88,359,656	Y787C	probably benign	Het
Ttc28	T	A	5: 111,276,208	V1447D	possibly damaging	Het
Ucp2	A	G	7: 100,498,254	I172V	probably benign	Het
Zzef1	T	A	11: 72,858,394	Y903N	probably damaging	Het

Other mutations in Uaca

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL01310:Uaca	APN	9	60872225	missense	probably benign
IGL01751:Uaca	APN	9	60869857	missense	probably damaging	1.00
IGL02868:Uaca	APN	9	60863637	missense	probably damaging	1.00
IGL02977:Uaca	APN	9	60866380	missense	probably benign	0.00
IGL03037:Uaca	APN	9	60840865	missense	probably damaging	1.00
IGL03060:Uaca	APN	9	60869866	missense	probably damaging	1.00
IGL03083:Uaca	APN	9	60863663	missense	probably benign	0.28
IGL03266:Uaca	APN	9	60863407	missense	probably damaging	1.00
IGL03346:Uaca	APN	9	60854318	missense	probably damaging	1.00
Ixtapa	UTSW	9	60870413	missense	probably damaging	0.99
oaxaca	UTSW	9	60871451	missense	probably benign
R0408:Uaca	UTSW	9	60871859	missense	possibly damaging	0.71
R0567:Uaca	UTSW	9	60871381	missense	probably benign	0.01
R0598:Uaca	UTSW	9	60870921	nonsense	probably null
R0603:Uaca	UTSW	9	60871097	missense	possibly damaging	0.60
R0655:Uaca	UTSW	9	60872029	missense	probably benign	0.03
R0707:Uaca	UTSW	9	60848618	splice site	probably benign
R0791:Uaca	UTSW	9	60872059	missense	possibly damaging	0.50
R1466:Uaca	UTSW	9	60854321	missense	possibly damaging	0.88
R1466:Uaca	UTSW	9	60854321	missense	possibly damaging	0.88
R1520:Uaca	UTSW	9	60871381	missense	probably benign	0.30
R1673:Uaca	UTSW	9	60872156	missense	probably damaging	1.00
R1894:Uaca	UTSW	9	60870436	missense	possibly damaging	0.87
R1997:Uaca	UTSW	9	60870341	missense	probably damaging	1.00
R2042:Uaca	UTSW	9	60869891	missense	probably damaging	1.00
R2095:Uaca	UTSW	9	60840843	missense	probably benign	0.00
R2148:Uaca	UTSW	9	60869679	missense	probably damaging	1.00
R3110:Uaca	UTSW	9	60871499	missense	probably damaging	1.00
R3112:Uaca	UTSW	9	60871499	missense	probably damaging	1.00
R4001:Uaca	UTSW	9	60871084	missense	probably benign	0.04
R4155:Uaca	UTSW	9	60871753	missense	probably benign	0.02
R4156:Uaca	UTSW	9	60871753	missense	probably benign	0.02
R4157:Uaca	UTSW	9	60871753	missense	probably benign	0.02
R4410:Uaca	UTSW	9	60869891	missense	probably damaging	1.00
R4674:Uaca	UTSW	9	60854429	missense	possibly damaging	0.94
R4871:Uaca	UTSW	9	60846001	missense	probably damaging	1.00
R5130:Uaca	UTSW	9	60880228	missense	probably damaging	0.96
R5328:Uaca	UTSW	9	60870532	missense	probably benign	0.44
R5358:Uaca	UTSW	9	60871148	missense	probably benign
R5415:Uaca	UTSW	9	60870139	missense	possibly damaging	0.65
R5437:Uaca	UTSW	9	60871451	missense	probably benign
R5647:Uaca	UTSW	9	60872098	missense	probably benign	0.28
R5710:Uaca	UTSW	9	60871811	missense	probably damaging	1.00
R5920:Uaca	UTSW	9	60869603	missense	probably benign	0.19
R5931:Uaca	UTSW	9	60872012	missense	probably damaging	0.97
R5933:Uaca	UTSW	9	60840956	missense	probably damaging	1.00
R5959:Uaca	UTSW	9	60870770	missense	probably damaging	1.00
R6193:Uaca	UTSW	9	60870044	missense	probably damaging	0.99
R6195:Uaca	UTSW	9	60870044	missense	probably damaging	0.99
R6242:Uaca	UTSW	9	60870044	missense	probably damaging	0.99
R6243:Uaca	UTSW	9	60870044	missense	probably damaging	0.99
R6244:Uaca	UTSW	9	60870044	missense	probably damaging	0.99
R6274:Uaca	UTSW	9	60850291	splice site	probably null
R6670:Uaca	UTSW	9	60872024	missense	probably benign	0.09
R6883:Uaca	UTSW	9	60869891	missense	probably damaging	1.00
R7011:Uaca	UTSW	9	60870368	missense	probably damaging	1.00
R7111:Uaca	UTSW	9	60871838	missense	probably benign	0.06
R7146:Uaca	UTSW	9	60870413	missense	probably damaging	0.99
R7424:Uaca	UTSW	9	60870110	missense	probably damaging	1.00
R7485:Uaca	UTSW	9	60846000	missense	probably damaging	1.00
R7510:Uaca	UTSW	9	60850205	splice site	probably null
R7688:Uaca	UTSW	9	60874127	missense	probably benign	0.11
R7724:Uaca	UTSW	9	60869905	missense	probably benign	0.24
R7743:Uaca	UTSW	9	60876395	missense	probably damaging	0.99
R8556:Uaca	UTSW	9	60870641	missense	probably damaging	0.97
X0067:Uaca	UTSW	9	60859149	missense	possibly damaging	0.69
Z1177:Uaca	UTSW	9	60874123	missense	probably damaging	1.00

Predicted Primers

PCR Primer
(F):5'- ACGAACTGGCTCACAAGGTG -3'
(R):5'- AGCTCGACTTCACATGTGC -3'

Sequencing Primer
(F):5'- CTCACAAGGTGGCGGAGTG -3'
(R):5'- GACTTCACATGTGCCGCATTC -3'

Posted On

2014-11-11