Incidental Mutation 'R2384:Nlrp4g'
ID247646
Institutional Source Beutler Lab
Gene Symbol Nlrp4g
Ensembl Gene ENSMUSG00000079741
Gene NameNLR family, pyrin domain containing 4G
Synonymsnalp4g
MMRRC Submission 040358-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.063) question?
Stock #R2384 (G1)
Quality Score225
Status Validated
Chromosome9
Chromosomal Location124348831-124354028 bp(+) (GRCm38)
Type of Mutationunclassified
DNA Base Change (assembly) A to G at 124349707 bp
ZygosityHeterozygous
Amino Acid Change
Gene Model predicted gene model for transcript(s):
Predicted Effect noncoding transcript
Transcript: ENSMUST00000067621
SMART Domains Protein: ENSMUSP00000065508
Gene: ENSMUSG00000079741

DomainStartEndE-ValueType
Pfam:NACHT 69 238 1.5e-39 PFAM
Blast:LRR 555 582 9e-10 BLAST
Blast:LRR 610 637 7e-10 BLAST
Predicted Effect noncoding transcript
Transcript: ENSMUST00000214229
Predicted Effect noncoding transcript
Transcript: ENSMUST00000215276
Predicted Effect noncoding transcript
Transcript: ENSMUST00000215602
Predicted Effect noncoding transcript
Transcript: ENSMUST00000216416
Predicted Effect noncoding transcript
Transcript: ENSMUST00000217178
Predicted Effect noncoding transcript
Transcript: ENSMUST00000217183
Meta Mutation Damage Score 0.2257 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.4%
  • 10x: 96.6%
  • 20x: 92.5%
Validation Efficiency 100% (37/37)
Allele List at MGI
Other mutations in this stock
Total: 35 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2700049A03Rik G T 12: 71,164,546 E685* probably null Het
2700049A03Rik A T 12: 71,164,547 E685V possibly damaging Het
4933414I15Rik A G 11: 50,942,506 S90P unknown Het
Abca13 T C 11: 9,267,450 probably benign Het
Chpf C T 1: 75,475,109 R567H probably benign Het
Cnp A G 11: 100,576,453 Y74C probably damaging Het
Cul3 A T 1: 80,283,689 V273D probably damaging Het
Dnmt3a A G 12: 3,901,591 Y656C probably damaging Het
Erich3 A T 3: 154,764,651 E107V possibly damaging Het
Fscn2 T C 11: 120,366,733 S307P possibly damaging Het
Gm156 T A 6: 129,772,380 H84L probably benign Het
Grm5 A G 7: 87,602,728 E62G probably damaging Het
Hdac4 T C 1: 91,984,485 Y394C probably benign Het
Hipk2 A G 6: 38,818,371 I314T probably damaging Het
Hsd17b12 T A 2: 94,033,619 I293L probably benign Het
Il1f9 A G 2: 24,192,648 H145R probably benign Het
Ints12 T A 3: 133,109,103 probably null Het
Khdrbs2 T C 1: 32,519,895 S369G probably damaging Het
Mup5 T A 4: 61,835,024 probably null Het
Obscn A G 11: 59,042,837 probably null Het
Ogdh C A 11: 6,342,526 A413D probably damaging Het
Podn T C 4: 108,022,072 E283G probably damaging Het
Ppp1r32 A C 19: 10,481,282 probably null Het
Ripk1 A G 13: 34,030,043 D456G probably benign Het
Scg3 T C 9: 75,665,726 T308A probably damaging Het
Sele A G 1: 164,050,775 T228A probably benign Het
Slc41a3 A G 6: 90,626,411 E138G probably damaging Het
Tmem161a T C 8: 70,177,554 V104A probably benign Het
Tmem232 G A 17: 65,402,857 R479W probably damaging Het
Trim26 C T 17: 36,850,889 P67S probably damaging Het
Trpm8 A G 1: 88,359,656 Y787C probably benign Het
Ttc28 T A 5: 111,276,208 V1447D possibly damaging Het
Uaca G A 9: 60,869,917 A527T probably damaging Het
Ucp2 A G 7: 100,498,254 I172V probably benign Het
Zzef1 T A 11: 72,858,394 Y903N probably damaging Het
Other mutations in Nlrp4g
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01066:Nlrp4g APN 9 124349526 unclassified noncoding transcript
IGL01087:Nlrp4g APN 9 124353858 critical splice acceptor site noncoding transcript
IGL01106:Nlrp4g APN 9 124350452 unclassified noncoding transcript
IGL01938:Nlrp4g APN 9 124349068 unclassified noncoding transcript
IGL02088:Nlrp4g APN 9 124350453 unclassified noncoding transcript
IGL02170:Nlrp4g APN 9 124348980 unclassified noncoding transcript
IGL02582:Nlrp4g APN 9 124349764 unclassified noncoding transcript
IGL02588:Nlrp4g APN 9 124348843 unclassified noncoding transcript
IGL02931:Nlrp4g APN 9 124348940 unclassified noncoding transcript
IGL03111:Nlrp4g APN 9 124353978 exon noncoding transcript
IGL03373:Nlrp4g APN 9 124349853 unclassified noncoding transcript
R0617:Nlrp4g UTSW 9 124349540 unclassified noncoding transcript
R1419:Nlrp4g UTSW 9 124349434 unclassified noncoding transcript
R2060:Nlrp4g UTSW 9 124349693 unclassified noncoding transcript
R2152:Nlrp4g UTSW 9 124353339 exon noncoding transcript
R2356:Nlrp4g UTSW 9 124349306 unclassified noncoding transcript
R2698:Nlrp4g UTSW 9 124349630 unclassified noncoding transcript
R3878:Nlrp4g UTSW 9 124349362 unclassified noncoding transcript
R4640:Nlrp4g UTSW 9 124349153 unclassified noncoding transcript
R4745:Nlrp4g UTSW 9 124349515 unclassified noncoding transcript
R4754:Nlrp4g UTSW 9 124349788 unclassified noncoding transcript
R4937:Nlrp4g UTSW 9 124354005 exon noncoding transcript
R5024:Nlrp4g UTSW 9 124350155 unclassified noncoding transcript
R5162:Nlrp4g UTSW 9 124350394 unclassified noncoding transcript
R5407:Nlrp4g UTSW 9 124349930 unclassified noncoding transcript
R5521:Nlrp4g UTSW 9 124350020 unclassified noncoding transcript
Z1088:Nlrp4g UTSW 9 124349201 unclassified noncoding transcript
Predicted Primers PCR Primer
(F):5'- GAAAACAGCAACTGCATTCGATG -3'
(R):5'- GATGTCAGAGTCCAAGATCCC -3'

Sequencing Primer
(F):5'- CCACAGATTGTTCCAAGATAAGATC -3'
(R):5'- GATGTCAGAGTCCAAGATCCCATTTC -3'
Posted On2014-11-11