Incidental Mutation 'R2384:Dnmt3a'
ID247656
Institutional Source Beutler Lab
Gene Symbol Dnmt3a
Ensembl Gene ENSMUSG00000020661
Gene NameDNA methyltransferase 3A
Synonyms
MMRRC Submission 040358-MU
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.498) question?
Stock #R2384 (G1)
Quality Score225
Status Validated
Chromosome12
Chromosomal Location3806007-3914443 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 3901591 bp
ZygosityHeterozygous
Amino Acid Change Tyrosine to Cysteine at position 656 (Y656C)
Ref Sequence ENSEMBL: ENSMUSP00000134009 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000020991] [ENSMUST00000111186] [ENSMUST00000172509] [ENSMUST00000172689] [ENSMUST00000174483] [ENSMUST00000174774] [ENSMUST00000174817]
Predicted Effect probably damaging
Transcript: ENSMUST00000020991
AA Change: Y656C

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000020991
Gene: ENSMUSG00000020661
AA Change: Y656C

DomainStartEndE-ValueType
low complexity region 2 13 N/A INTRINSIC
low complexity region 15 37 N/A INTRINSIC
internal_repeat_1 55 101 6.44e-5 PROSPERO
low complexity region 109 124 N/A INTRINSIC
low complexity region 160 177 N/A INTRINSIC
low complexity region 204 215 N/A INTRINSIC
internal_repeat_1 241 283 6.44e-5 PROSPERO
PWWP 286 344 1.36e-24 SMART
low complexity region 412 430 N/A INTRINSIC
low complexity region 438 453 N/A INTRINSIC
PDB:3A1B|A 454 610 2e-99 PDB
Blast:RING 533 582 1e-17 BLAST
Pfam:DNA_methylase 630 772 2.1e-14 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000111186
AA Change: Y437C

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000106817
Gene: ENSMUSG00000020661
AA Change: Y437C

DomainStartEndE-ValueType
PWWP 67 125 1.36e-24 SMART
low complexity region 193 211 N/A INTRINSIC
low complexity region 219 234 N/A INTRINSIC
PDB:3A1B|A 235 391 1e-101 PDB
Blast:RING 314 363 4e-16 BLAST
Pfam:DNA_methylase 411 554 9.5e-15 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000172509
SMART Domains Protein: ENSMUSP00000133869
Gene: ENSMUSG00000020661

DomainStartEndE-ValueType
low complexity region 35 50 N/A INTRINSIC
low complexity region 86 103 N/A INTRINSIC
low complexity region 130 141 N/A INTRINSIC
PWWP 212 270 1.36e-24 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000172689
AA Change: Y437C

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000133543
Gene: ENSMUSG00000020661
AA Change: Y437C

DomainStartEndE-ValueType
PWWP 67 125 1.36e-24 SMART
low complexity region 193 211 N/A INTRINSIC
low complexity region 219 234 N/A INTRINSIC
PDB:3A1B|A 235 391 1e-101 PDB
Blast:RING 314 363 4e-16 BLAST
Pfam:DNA_methylase 411 554 9.5e-15 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000172749
SMART Domains Protein: ENSMUSP00000134567
Gene: ENSMUSG00000020661

DomainStartEndE-ValueType
PWWP 61 119 7.62e-19 SMART
low complexity region 151 169 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000174272
Predicted Effect probably benign
Transcript: ENSMUST00000174483
SMART Domains Protein: ENSMUSP00000133938
Gene: ENSMUSG00000020661

DomainStartEndE-ValueType
low complexity region 35 50 N/A INTRINSIC
Predicted Effect unknown
Transcript: ENSMUST00000174733
AA Change: Y41C
SMART Domains Protein: ENSMUSP00000134492
Gene: ENSMUSG00000020661
AA Change: Y41C

DomainStartEndE-ValueType
Pfam:DNA_methylase 16 104 8.2e-10 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000174774
SMART Domains Protein: ENSMUSP00000134529
Gene: ENSMUSG00000020661

DomainStartEndE-ValueType
PWWP 67 125 1.36e-24 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000174817
AA Change: Y656C

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000134009
Gene: ENSMUSG00000020661
AA Change: Y656C

DomainStartEndE-ValueType
low complexity region 2 13 N/A INTRINSIC
low complexity region 15 37 N/A INTRINSIC
internal_repeat_1 55 101 6.44e-5 PROSPERO
low complexity region 109 124 N/A INTRINSIC
low complexity region 160 177 N/A INTRINSIC
low complexity region 204 215 N/A INTRINSIC
internal_repeat_1 241 283 6.44e-5 PROSPERO
PWWP 286 344 1.36e-24 SMART
low complexity region 412 430 N/A INTRINSIC
low complexity region 438 453 N/A INTRINSIC
PDB:3A1B|A 454 610 2e-99 PDB
Blast:RING 533 582 1e-17 BLAST
Pfam:DNA_methylase 630 772 2.1e-14 PFAM
Meta Mutation Damage Score 0.8620 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.4%
  • 10x: 96.6%
  • 20x: 92.5%
Validation Efficiency 100% (37/37)
MGI Phenotype FUNCTION: This is one of two related genes encoding de novo DNA methyltransferases, which are responsible for the establishment of DNA methylation patterns in embryos. Loss of function of this gene causes developmental defects in multiple different organ systems. There is a pseudogene for this gene located on chromosome 3. Alternatively spliced transcript variants encoding multiple isoforms have been observed. [provided by RefSeq, Nov 2012]
PHENOTYPE: Homozygotes for a targeted null mutation become runted and die around four weeks of age. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 35 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2700049A03Rik G T 12: 71,164,546 E685* probably null Het
2700049A03Rik A T 12: 71,164,547 E685V possibly damaging Het
4933414I15Rik A G 11: 50,942,506 S90P unknown Het
Abca13 T C 11: 9,267,450 probably benign Het
Chpf C T 1: 75,475,109 R567H probably benign Het
Cnp A G 11: 100,576,453 Y74C probably damaging Het
Cul3 A T 1: 80,283,689 V273D probably damaging Het
Erich3 A T 3: 154,764,651 E107V possibly damaging Het
Fscn2 T C 11: 120,366,733 S307P possibly damaging Het
Gm156 T A 6: 129,772,380 H84L probably benign Het
Grm5 A G 7: 87,602,728 E62G probably damaging Het
Hdac4 T C 1: 91,984,485 Y394C probably benign Het
Hipk2 A G 6: 38,818,371 I314T probably damaging Het
Hsd17b12 T A 2: 94,033,619 I293L probably benign Het
Il1f9 A G 2: 24,192,648 H145R probably benign Het
Ints12 T A 3: 133,109,103 probably null Het
Khdrbs2 T C 1: 32,519,895 S369G probably damaging Het
Mup5 T A 4: 61,835,024 probably null Het
Nlrp4g A G 9: 124,349,707 noncoding transcript Het
Obscn A G 11: 59,042,837 probably null Het
Ogdh C A 11: 6,342,526 A413D probably damaging Het
Podn T C 4: 108,022,072 E283G probably damaging Het
Ppp1r32 A C 19: 10,481,282 probably null Het
Ripk1 A G 13: 34,030,043 D456G probably benign Het
Scg3 T C 9: 75,665,726 T308A probably damaging Het
Sele A G 1: 164,050,775 T228A probably benign Het
Slc41a3 A G 6: 90,626,411 E138G probably damaging Het
Tmem161a T C 8: 70,177,554 V104A probably benign Het
Tmem232 G A 17: 65,402,857 R479W probably damaging Het
Trim26 C T 17: 36,850,889 P67S probably damaging Het
Trpm8 A G 1: 88,359,656 Y787C probably benign Het
Ttc28 T A 5: 111,276,208 V1447D possibly damaging Het
Uaca G A 9: 60,869,917 A527T probably damaging Het
Ucp2 A G 7: 100,498,254 I172V probably benign Het
Zzef1 T A 11: 72,858,394 Y903N probably damaging Het
Other mutations in Dnmt3a
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00844:Dnmt3a APN 12 3905622 missense probably damaging 1.00
IGL02255:Dnmt3a APN 12 3872886 splice site probably benign
IGL02815:Dnmt3a APN 12 3904226 critical splice donor site probably null
IGL03372:Dnmt3a APN 12 3902666 missense probably damaging 1.00
R0028:Dnmt3a UTSW 12 3900337 missense probably damaging 0.99
R0306:Dnmt3a UTSW 12 3866096 missense possibly damaging 0.69
R0843:Dnmt3a UTSW 12 3872886 splice site probably benign
R1055:Dnmt3a UTSW 12 3872864 missense probably benign 0.05
R1465:Dnmt3a UTSW 12 3866088 missense probably damaging 1.00
R1465:Dnmt3a UTSW 12 3866088 missense probably damaging 1.00
R1585:Dnmt3a UTSW 12 3901660 missense probably damaging 0.99
R1680:Dnmt3a UTSW 12 3873361 missense probably damaging 0.97
R1753:Dnmt3a UTSW 12 3873342 missense possibly damaging 0.54
R2055:Dnmt3a UTSW 12 3872859 missense probably benign 0.44
R2219:Dnmt3a UTSW 12 3849654 utr 5 prime probably benign
R2267:Dnmt3a UTSW 12 3897551 splice site probably null
R2359:Dnmt3a UTSW 12 3901599 missense probably damaging 1.00
R2403:Dnmt3a UTSW 12 3899883 missense probably damaging 1.00
R2884:Dnmt3a UTSW 12 3896132 missense probably damaging 1.00
R3027:Dnmt3a UTSW 12 3849626 splice site probably null
R4281:Dnmt3a UTSW 12 3901665 missense probably damaging 1.00
R4282:Dnmt3a UTSW 12 3901665 missense probably damaging 1.00
R4283:Dnmt3a UTSW 12 3901665 missense probably damaging 1.00
R4809:Dnmt3a UTSW 12 3900352 missense probably damaging 1.00
R5154:Dnmt3a UTSW 12 3896008 missense probably damaging 1.00
R5361:Dnmt3a UTSW 12 3895643 missense probably benign 0.13
R5483:Dnmt3a UTSW 12 3899615 missense probably damaging 1.00
R5768:Dnmt3a UTSW 12 3885660 splice site probably null
R5928:Dnmt3a UTSW 12 3866096 missense possibly damaging 0.69
R6432:Dnmt3a UTSW 12 3902399 missense probably damaging 0.99
R6552:Dnmt3a UTSW 12 3907623 missense probably damaging 1.00
R6783:Dnmt3a UTSW 12 3897406 missense probably damaging 0.99
R6850:Dnmt3a UTSW 12 3897600 missense probably benign 0.40
R7106:Dnmt3a UTSW 12 3897591 missense probably damaging 0.99
R7145:Dnmt3a UTSW 12 3872844 missense probably benign 0.01
R7149:Dnmt3a UTSW 12 3902397 missense probably damaging 1.00
R7239:Dnmt3a UTSW 12 3872850 missense probably benign 0.01
R7490:Dnmt3a UTSW 12 3904204 missense probably damaging 1.00
R7588:Dnmt3a UTSW 12 3896080 missense possibly damaging 0.91
R7684:Dnmt3a UTSW 12 3897340 missense probably benign 0.02
R8058:Dnmt3a UTSW 12 3902768 missense possibly damaging 0.92
R8316:Dnmt3a UTSW 12 3896965 missense probably benign 0.00
R8345:Dnmt3a UTSW 12 3835234 missense unknown
Z1176:Dnmt3a UTSW 12 3904201 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- CTGTCCTGGCTTTGGAAAGAC -3'
(R):5'- AGGAGTGGATGGCAATGTCC -3'

Sequencing Primer
(F):5'- TGAGGCACAGTCATAGCGC -3'
(R):5'- ATGGCAATGTCCCCAGGAG -3'
Posted On2014-11-11