Incidental Mutation 'R0299:Il1r2'
ID24766
Institutional Source Beutler Lab
Gene Symbol Il1r2
Ensembl Gene ENSMUSG00000026073
Gene Nameinterleukin 1 receptor, type II
SynonymsIL-1 receptor beta chain, CD121b, Il1r-2
MMRRC Submission 038513-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R0299 (G1)
Quality Score225
Status Validated
Chromosome1
Chromosomal Location40074079-40125231 bp(+) (GRCm38)
Type of Mutationnonsense
DNA Base Change (assembly) T to A at 40123149 bp
ZygosityHeterozygous
Amino Acid Change Tyrosine to Stop codon at position 317 (Y317*)
Ref Sequence ENSEMBL: ENSMUSP00000027243 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000027243] [ENSMUST00000195770]
Predicted Effect probably null
Transcript: ENSMUST00000027243
AA Change: Y317*
SMART Domains Protein: ENSMUSP00000027243
Gene: ENSMUSG00000026073
AA Change: Y317*

DomainStartEndE-ValueType
IG 49 138 2.48e-8 SMART
IG 149 241 1.6e-2 SMART
IG 255 354 1.32e-3 SMART
transmembrane domain 359 381 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000195770
Meta Mutation Damage Score 0.9755 question?
Coding Region Coverage
  • 1x: 98.8%
  • 3x: 97.8%
  • 10x: 95.3%
  • 20x: 90.1%
Validation Efficiency 100% (61/61)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a cytokine receptor that belongs to the interleukin 1 receptor family. This protein binds interleukin alpha (IL1A), interleukin beta (IL1B), and interleukin 1 receptor, type I(IL1R1/IL1RA), and acts as a decoy receptor that inhibits the activity of its ligands. Interleukin 4 (IL4) is reported to antagonize the activity of interleukin 1 by inducing the expression and release of this cytokine. This gene and three other genes form a cytokine receptor gene cluster on chromosome 2q12. Alternative splicing results in multiple transcript variants and protein isoforms. Alternative splicing produces both membrane-bound and soluble proteins. A soluble protein is also produced by proteolytic cleavage. [provided by RefSeq, May 2012]
Allele List at MGI
Other mutations in this stock
Total: 62 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930503L19Rik G A 18: 70,469,482 Q87* probably null Het
4933427I04Rik A T 4: 123,860,822 R176S possibly damaging Het
A2ml1 T G 6: 128,553,232 probably benign Het
Abca13 G A 11: 9,298,076 E2608K probably benign Het
Acpp T C 9: 104,320,002 E146G probably damaging Het
Adcy8 T A 15: 64,716,166 D894V probably damaging Het
Ap4b1 T C 3: 103,809,946 M1T probably null Het
Arg2 A G 12: 79,147,612 D70G probably damaging Het
Atxn1 A G 13: 45,567,169 S417P probably damaging Het
Btbd10 A T 7: 113,329,878 S230T possibly damaging Het
Carmil1 T A 13: 24,082,020 N253I probably damaging Het
Celf6 C A 9: 59,602,878 T86K probably benign Het
Clec2h T C 6: 128,670,895 V69A probably damaging Het
Col15a1 A T 4: 47,262,950 D534V probably damaging Het
Col16a1 TCCCC TCCC 4: 130,058,318 probably null Het
Degs1 A T 1: 182,279,271 I141N probably damaging Het
Dnah1 C T 14: 31,276,158 G2574D probably damaging Het
Dnah8 T A 17: 30,715,509 F1489L possibly damaging Het
Dock10 T C 1: 80,536,929 R1424G probably damaging Het
Elp2 T C 18: 24,634,409 I716T probably benign Het
Frk T C 10: 34,484,371 probably null Het
Fshr C G 17: 89,009,285 S169T probably benign Het
Gin1 T A 1: 97,783,016 S141R possibly damaging Het
Gm11596 G A 11: 99,792,944 P117S unknown Het
Gm6327 T C 16: 12,761,197 noncoding transcript Het
Hepacam2 A G 6: 3,476,121 L268P probably damaging Het
Hps6 G A 19: 46,004,232 V203M probably damaging Het
Hsd17b7 G A 1: 169,959,794 probably benign Het
Il18rap A T 1: 40,525,058 H112L probably benign Het
Ints8 C A 4: 11,246,097 V190L probably benign Het
Me2 A G 18: 73,770,673 S575P probably benign Het
Mecom A G 3: 29,980,411 L372P probably benign Het
Mss51 T A 14: 20,484,688 Q338L possibly damaging Het
Muc2 C T 7: 141,752,729 T296I probably damaging Het
Muc4 A T 16: 32,750,195 probably benign Het
Neto1 G A 18: 86,461,320 R211Q probably benign Het
Nisch A G 14: 31,171,924 Y1231H probably damaging Het
Olfr1331 A G 4: 118,869,416 I212V probably benign Het
Olfr1338 A T 4: 118,754,535 M1K probably null Het
Pcsk6 T C 7: 66,039,043 V820A probably benign Het
Pdcd10 T C 3: 75,527,651 K111R probably damaging Het
Pdgfrb T A 18: 61,068,852 V496E probably benign Het
Pelo A T 13: 115,088,903 C40* probably null Het
Plxnc1 C T 10: 94,849,821 probably null Het
Ptpru G A 4: 131,803,387 Q519* probably null Het
Pzp A G 6: 128,495,330 probably benign Het
Rad21 A T 15: 51,965,030 D547E probably benign Het
Serpina1d A T 12: 103,765,757 L281Q probably damaging Het
Serpina9 T C 12: 104,001,470 N222S probably benign Het
Sh3bgrl2 A G 9: 83,577,559 K57E probably damaging Het
Shtn1 T C 19: 59,018,951 E289G probably benign Het
Sik3 T C 9: 46,208,740 M659T possibly damaging Het
Slamf7 G A 1: 171,648,931 probably benign Het
Sppl3 T A 5: 115,088,994 probably benign Het
Suco G A 1: 161,853,810 T253I probably benign Het
Tecta T C 9: 42,352,063 D1409G probably damaging Het
Tram2 T C 1: 21,004,244 D238G probably damaging Het
Trpm3 T C 19: 22,986,873 M1244T possibly damaging Het
Trub1 A G 19: 57,483,625 T178A possibly damaging Het
Ugcg G C 4: 59,217,036 V187L possibly damaging Het
Vmn1r25 T A 6: 57,978,509 Q265L probably damaging Het
Zfp821 G T 8: 109,724,230 R285L probably damaging Het
Other mutations in Il1r2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01945:Il1r2 APN 1 40102453 missense possibly damaging 0.66
IGL02673:Il1r2 APN 1 40115163 missense probably damaging 1.00
R0019:Il1r2 UTSW 1 40125050 missense probably damaging 1.00
R0019:Il1r2 UTSW 1 40125050 missense probably damaging 1.00
R0499:Il1r2 UTSW 1 40123149 nonsense probably null
R0607:Il1r2 UTSW 1 40105455 missense probably benign 0.06
R1435:Il1r2 UTSW 1 40105299 missense probably damaging 0.99
R1925:Il1r2 UTSW 1 40115148 missense probably damaging 0.99
R2209:Il1r2 UTSW 1 40115138 missense probably benign 0.02
R2240:Il1r2 UTSW 1 40105470 missense probably damaging 1.00
R4997:Il1r2 UTSW 1 40121046 critical splice donor site probably null
R7273:Il1r2 UTSW 1 40112007 missense probably benign 0.06
R7331:Il1r2 UTSW 1 40123249 missense probably benign 0.11
R7401:Il1r2 UTSW 1 40123210 missense probably damaging 1.00
R7751:Il1r2 UTSW 1 40123211 missense probably damaging 1.00
R7841:Il1r2 UTSW 1 40105468 missense probably damaging 1.00
R7924:Il1r2 UTSW 1 40105468 missense probably damaging 1.00
X0010:Il1r2 UTSW 1 40117981 missense probably benign 0.16
Predicted Primers PCR Primer
(F):5'- GCTCTACACACATCATGCTCTGCATAC -3'
(R):5'- GCTTTCAGTGCCCTACAAGAAGACATC -3'

Sequencing Primer
(F):5'- catcatgctctgcatacatacatc -3'
(R):5'- TGCCCTACAAGAAGACATCTAAATAC -3'
Posted On2013-04-16