Mutagenetix > Incidental Mutations

Incidental Mutation 'R2385:Aox3'

247666

Institutional Source

Beutler Lab

Gene Symbol

Aox3

Ensembl Gene

ENSMUSG00000064294

Gene Name

aldehyde oxidase 3

Synonyms

AOH1, 1200011D03Rik

Accession Numbers

Is this an essential gene?

Non essential (E-score: 0.000) question?

Stock #

R2385 (G1)

Quality Score

225

Status

Not validated

Chromosome

Chromosomal Location

58113130-58200698 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to G at 58138289 bp

Zygosity

Heterozygous

Amino Acid Change

Glutamic Acid to Glycine at position 221 (E221G)

Ref Sequence

ENSEMBL: ENSMUSP00000140140 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000040999] [ENSMUST00000162011]

Predicted Effect

probably damaging
Transcript: ENSMUST00000040999
AA Change: E221G

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

SMART Domains

Protein: ENSMUSP00000049391
Gene: ENSMUSG00000064294
AA Change: E221G

Domain	Start	End	E-Value	Type
Pfam:Fer2	12	82	1.4e-9	PFAM
Pfam:Fer2_2	91	165	1e-29	PFAM
Pfam:FAD_binding_5	239	419	1e-44	PFAM
CO_deh_flav_C	426	530	9.26e-24	SMART
Ald_Xan_dh_C	594	697	2.27e-41	SMART
Pfam:Ald_Xan_dh_C2	708	1241	8.7e-183	PFAM
low complexity region	1275	1286	N/A	INTRINSIC

Predicted Effect

probably damaging
Transcript: ENSMUST00000162011
AA Change: E221G

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

SMART Domains

Protein: ENSMUSP00000140140
Gene: ENSMUSG00000064294
AA Change: E221G

Domain	Start	End	E-Value	Type
Pfam:Fer2	12	82	3.6e-8	PFAM
Pfam:Fer2_2	91	166	2.5e-29	PFAM
transmembrane domain	242	264	N/A	INTRINSIC

Coding Region Coverage

1x: 99.1%
3x: 98.5%
10x: 97.0%
20x: 94.1%

Validation Efficiency

Allele List at MGI

Other mutations in this stock

Total: 19 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Abra	T	C	15: 41,869,353	T106A	probably damaging	Het
Adgra3	A	T	5: 49,979,566	I595N	possibly damaging	Het
Arpc1a	T	A	5: 145,104,523		probably null	Het
Cd180	A	G	13: 102,705,183	T246A	probably benign	Het
Cep250	A	G	2: 155,974,341	E672G	probably damaging	Het
Cyp2d12	A	T	15: 82,558,495	I380F	probably benign	Het
Dock3	A	T	9: 106,991,125	D653E	probably damaging	Het
Fbxw22	A	G	9: 109,382,142	S364P	probably damaging	Het
Ift122	T	C	6: 115,912,522	Y823H	probably benign	Het
Kif20b	T	C	19: 34,959,419	S1365P	probably damaging	Het
Nol11	C	T	11: 107,189,206	G18R	probably benign	Het
Olfr1047	A	T	2: 86,228,473	L166*	probably null	Het
Pde8a	T	G	7: 81,282,992	M134R	probably benign	Het
Pmepa1	G	A	2: 173,228,133	R210W	probably damaging	Het
Polr3gl	A	G	3: 96,578,546	F135L	probably damaging	Het
Sdr16c6	T	A	4: 4,062,671	I216F	probably damaging	Het
Slc23a2	T	C	2: 132,089,201	D126G	probably benign	Het
Snx13	A	T	12: 35,119,793	Y579F	probably benign	Het
Vcan	T	C	13: 89,689,449	T1699A	probably damaging	Het

Other mutations in Aox3

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL01599:Aox3	APN	1	58169794	missense	probably damaging	1.00
IGL01747:Aox3	APN	1	58159658	missense	probably damaging	0.97
IGL01883:Aox3	APN	1	58138283	missense	probably damaging	1.00
IGL01911:Aox3	APN	1	58152560	missense	probably benign	0.04
IGL02017:Aox3	APN	1	58120992	missense	probably damaging	1.00
IGL02120:Aox3	APN	1	58127650	missense	probably benign	0.00
IGL02466:Aox3	APN	1	58158272	missense	probably benign	0.28
IGL02545:Aox3	APN	1	58183486	missense	probably damaging	1.00
IGL02572:Aox3	APN	1	58158367	missense	probably damaging	1.00
IGL02746:Aox3	APN	1	58183542	missense	possibly damaging	0.83
IGL02808:Aox3	APN	1	58142700	missense	probably damaging	0.99
IGL02812:Aox3	APN	1	58165896	missense	probably benign	0.00
IGL02982:Aox3	APN	1	58127687	missense	probably benign	0.00
IGL03056:Aox3	APN	1	58159021	critical splice donor site	probably null
IGL03182:Aox3	APN	1	58165887	missense	probably benign	0.02
IGL03234:Aox3	APN	1	58152686	missense	probably benign
IGL03374:Aox3	APN	1	58171848	missense	probably damaging	1.00
amber	UTSW	1	58171891	nonsense	probably null
R0071:Aox3	UTSW	1	58171891	nonsense	probably null
R0071:Aox3	UTSW	1	58171891	nonsense	probably null
R0135:Aox3	UTSW	1	58125088	splice site	probably benign
R0332:Aox3	UTSW	1	58142751	missense	probably benign	0.00
R0626:Aox3	UTSW	1	58172299	missense	possibly damaging	0.94
R1325:Aox3	UTSW	1	58176567	nonsense	probably null
R1435:Aox3	UTSW	1	58163446	critical splice donor site	probably null
R1438:Aox3	UTSW	1	58153178	missense	probably benign
R1567:Aox3	UTSW	1	58194693	missense	probably damaging	0.96
R1575:Aox3	UTSW	1	58152554	missense	probably benign	0.04
R1759:Aox3	UTSW	1	58170646	splice site	probably null
R1785:Aox3	UTSW	1	58169843	missense	probably damaging	1.00
R1786:Aox3	UTSW	1	58169843	missense	probably damaging	1.00
R1921:Aox3	UTSW	1	58180651	missense	probably damaging	1.00
R1984:Aox3	UTSW	1	58153061	missense	possibly damaging	0.88
R2012:Aox3	UTSW	1	58138232	missense	probably benign	0.02
R2080:Aox3	UTSW	1	58186280	missense	probably benign	0.06
R2121:Aox3	UTSW	1	58152549	splice site	probably benign
R2126:Aox3	UTSW	1	58158216	missense	probably benign	0.25
R2130:Aox3	UTSW	1	58169843	missense	probably damaging	1.00
R2131:Aox3	UTSW	1	58169843	missense	probably damaging	1.00
R2132:Aox3	UTSW	1	58169843	missense	probably damaging	1.00
R2133:Aox3	UTSW	1	58169843	missense	probably damaging	1.00
R2495:Aox3	UTSW	1	58188408	missense	probably damaging	0.99
R4200:Aox3	UTSW	1	58188378	missense	probably damaging	1.00
R4231:Aox3	UTSW	1	58114885	missense	probably benign	0.12
R4591:Aox3	UTSW	1	58152656	missense	probably damaging	0.99
R4627:Aox3	UTSW	1	58125035	missense	probably damaging	0.98
R4831:Aox3	UTSW	1	58152566	missense	probably damaging	0.97
R4864:Aox3	UTSW	1	58176487	missense	probably damaging	1.00
R4976:Aox3	UTSW	1	58188524	critical splice donor site	probably null
R5007:Aox3	UTSW	1	58163424	missense	probably benign
R5119:Aox3	UTSW	1	58188524	critical splice donor site	probably null
R5175:Aox3	UTSW	1	58172328	missense	probably benign	0.01
R5360:Aox3	UTSW	1	58146508	missense	probably damaging	1.00
R5784:Aox3	UTSW	1	58153499	missense	probably benign	0.00
R6050:Aox3	UTSW	1	58180655	missense	possibly damaging	0.93
R6056:Aox3	UTSW	1	58169859	missense	probably damaging	1.00
R6162:Aox3	UTSW	1	58159731	missense	possibly damaging	0.75
R6181:Aox3	UTSW	1	58158946	missense	probably benign	0.03
R6374:Aox3	UTSW	1	58172161	missense	probably benign	0.11
R6662:Aox3	UTSW	1	58118615	missense	probably damaging	1.00
R6809:Aox3	UTSW	1	58118681	missense	probably damaging	0.99
R6810:Aox3	UTSW	1	58141431	missense	probably benign	0.00
R6821:Aox3	UTSW	1	58150388	missense	probably benign	0.04
R7039:Aox3	UTSW	1	58176555	missense	probably damaging	1.00
R7116:Aox3	UTSW	1	58153530	missense	probably benign	0.01
R7146:Aox3	UTSW	1	58158529	splice site	probably null
R7163:Aox3	UTSW	1	58119512	missense	probably damaging	0.99
R7243:Aox3	UTSW	1	58138307	missense	unknown
R7319:Aox3	UTSW	1	58152602	missense	probably benign	0.04
R7423:Aox3	UTSW	1	58121069	missense	possibly damaging	0.80
R7664:Aox3	UTSW	1	58119539	missense	probably damaging	1.00
R7709:Aox3	UTSW	1	58180651	missense	probably damaging	1.00
R7745:Aox3	UTSW	1	58176517	missense	possibly damaging	0.75
R7751:Aox3	UTSW	1	58179335	missense	probably benign	0.11
R7912:Aox3	UTSW	1	58142696	missense	probably benign	0.05
R7940:Aox3	UTSW	1	58188437	missense	probably damaging	1.00
R8143:Aox3	UTSW	1	58158915	missense	probably benign	0.05
R8178:Aox3	UTSW	1	58150322	missense	possibly damaging	0.64

Predicted Primers

PCR Primer
(F):5'- CCCCAGTCCAGGCTTTTCAAAC -3'
(R):5'- TGAGTTCCAGAACACGTGTGC -3'

Sequencing Primer
(F):5'- TCCAGGCTTTTCAAACAGGAAG -3'
(R):5'- GTGCCCTGGATCTAGACAATG -3'

Posted On

2014-11-11