Incidental Mutation 'R2385:Fbxw22'
ID247680
Institutional Source Beutler Lab
Gene Symbol Fbxw22
Ensembl Gene ENSMUSG00000070324
Gene NameF-box and WD-40 domain protein 22
SynonymsGm5164
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.058) question?
Stock #R2385 (G1)
Quality Score225
Status Not validated
Chromosome9
Chromosomal Location109378400-109404296 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 109382142 bp
ZygosityHeterozygous
Amino Acid Change Serine to Proline at position 364 (S364P)
Ref Sequence ENSEMBL: ENSMUSP00000079460 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000080626] [ENSMUST00000197213]
Predicted Effect probably damaging
Transcript: ENSMUST00000080626
AA Change: S364P

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000079460
Gene: ENSMUSG00000070324
AA Change: S364P

DomainStartEndE-ValueType
FBOX 5 45 1.02e-5 SMART
SCOP:d1gxra_ 128 220 1e-5 SMART
Blast:WD40 137 176 6e-9 BLAST
Predicted Effect probably benign
Transcript: ENSMUST00000197213
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.5%
  • 10x: 97.0%
  • 20x: 94.1%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 19 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abra T C 15: 41,869,353 T106A probably damaging Het
Adgra3 A T 5: 49,979,566 I595N possibly damaging Het
Aox3 A G 1: 58,138,289 E221G probably damaging Het
Arpc1a T A 5: 145,104,523 probably null Het
Cd180 A G 13: 102,705,183 T246A probably benign Het
Cep250 A G 2: 155,974,341 E672G probably damaging Het
Cyp2d12 A T 15: 82,558,495 I380F probably benign Het
Dock3 A T 9: 106,991,125 D653E probably damaging Het
Ift122 T C 6: 115,912,522 Y823H probably benign Het
Kif20b T C 19: 34,959,419 S1365P probably damaging Het
Nol11 C T 11: 107,189,206 G18R probably benign Het
Olfr1047 A T 2: 86,228,473 L166* probably null Het
Pde8a T G 7: 81,282,992 M134R probably benign Het
Pmepa1 G A 2: 173,228,133 R210W probably damaging Het
Polr3gl A G 3: 96,578,546 F135L probably damaging Het
Sdr16c6 T A 4: 4,062,671 I216F probably damaging Het
Slc23a2 T C 2: 132,089,201 D126G probably benign Het
Snx13 A T 12: 35,119,793 Y579F probably benign Het
Vcan T C 13: 89,689,449 T1699A probably damaging Het
Other mutations in Fbxw22
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00592:Fbxw22 APN 9 109384040 missense possibly damaging 0.68
IGL00655:Fbxw22 APN 9 109382244 splice site probably benign
IGL01122:Fbxw22 APN 9 109386671 missense probably damaging 0.99
IGL01419:Fbxw22 APN 9 109381722 missense probably benign 0.03
IGL01455:Fbxw22 APN 9 109384994 missense probably benign
IGL01486:Fbxw22 APN 9 109378873 missense probably damaging 1.00
IGL01734:Fbxw22 APN 9 109383925 missense probably damaging 0.98
IGL02106:Fbxw22 APN 9 109402019 missense possibly damaging 0.86
IGL02255:Fbxw22 APN 9 109386551 splice site probably benign
IGL02466:Fbxw22 APN 9 109385092 missense probably damaging 1.00
IGL02820:Fbxw22 APN 9 109386664 missense probably damaging 1.00
R0395:Fbxw22 UTSW 9 109381685 missense probably damaging 1.00
R0705:Fbxw22 UTSW 9 109403096 missense possibly damaging 0.92
R0741:Fbxw22 UTSW 9 109382219 missense probably benign 0.01
R1603:Fbxw22 UTSW 9 109378847 missense probably benign 0.00
R1673:Fbxw22 UTSW 9 109382128 missense possibly damaging 0.93
R1874:Fbxw22 UTSW 9 109385111 nonsense probably null
R2265:Fbxw22 UTSW 9 109383994 missense probably benign 0.02
R2269:Fbxw22 UTSW 9 109383994 missense probably benign 0.02
R4329:Fbxw22 UTSW 9 109384043 missense probably damaging 1.00
R4695:Fbxw22 UTSW 9 109378871 missense probably damaging 1.00
R4731:Fbxw22 UTSW 9 109378869 missense probably benign 0.02
R4915:Fbxw22 UTSW 9 109383941 missense probably damaging 1.00
R5010:Fbxw22 UTSW 9 109403424 missense probably benign 0.40
R5070:Fbxw22 UTSW 9 109385115 missense probably benign
R5319:Fbxw22 UTSW 9 109383947 missense possibly damaging 0.52
R5571:Fbxw22 UTSW 9 109403088 missense probably damaging 1.00
R5765:Fbxw22 UTSW 9 109384996 missense probably benign 0.00
R5846:Fbxw22 UTSW 9 109386761 missense probably benign
R6002:Fbxw22 UTSW 9 109381682 nonsense probably null
R6180:Fbxw22 UTSW 9 109386679 missense probably damaging 1.00
R6313:Fbxw22 UTSW 9 109403397 missense probably damaging 0.99
R6860:Fbxw22 UTSW 9 109383962 missense probably benign 0.01
R6949:Fbxw22 UTSW 9 109382076 missense probably benign 0.06
R7084:Fbxw22 UTSW 9 109404223 missense probably damaging 1.00
R7296:Fbxw22 UTSW 9 109382075 missense probably benign
R8499:Fbxw22 UTSW 9 109385000 missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- AGTAGGCTGCAGTCAATGTCAG -3'
(R):5'- ACTAGCATGCCATGGAAGG -3'

Sequencing Primer
(F):5'- TGCTCTGAGCCCATGTAAAG -3'
(R):5'- CCATGGAAGGAGGGATATGCTTTTC -3'
Posted On2014-11-11