Incidental Mutation 'R2385:Abra'
ID247686
Institutional Source Beutler Lab
Gene Symbol Abra
Ensembl Gene ENSMUSG00000042895
Gene Nameactin-binding Rho activating protein
SynonymsSTARS, C130068O12Rik
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.183) question?
Stock #R2385 (G1)
Quality Score225
Status Not validated
Chromosome15
Chromosomal Location41864076-41869720 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 41869353 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Alanine at position 106 (T106A)
Ref Sequence ENSEMBL: ENSMUSP00000051973 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000054742]
Predicted Effect probably damaging
Transcript: ENSMUST00000054742
AA Change: T106A

PolyPhen 2 Score 0.973 (Sensitivity: 0.76; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000051973
Gene: ENSMUSG00000042895
AA Change: T106A

DomainStartEndE-ValueType
Costars 298 374 6.22e-45 SMART
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.5%
  • 10x: 97.0%
  • 20x: 94.1%
Validation Efficiency
MGI Phenotype PHENOTYPE: Mice homozygous for a knock-out allele exhibit impaired arteriogenesis following occlusion. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 19 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adgra3 A T 5: 49,979,566 I595N possibly damaging Het
Aox3 A G 1: 58,138,289 E221G probably damaging Het
Arpc1a T A 5: 145,104,523 probably null Het
Cd180 A G 13: 102,705,183 T246A probably benign Het
Cep250 A G 2: 155,974,341 E672G probably damaging Het
Cyp2d12 A T 15: 82,558,495 I380F probably benign Het
Dock3 A T 9: 106,991,125 D653E probably damaging Het
Fbxw22 A G 9: 109,382,142 S364P probably damaging Het
Ift122 T C 6: 115,912,522 Y823H probably benign Het
Kif20b T C 19: 34,959,419 S1365P probably damaging Het
Nol11 C T 11: 107,189,206 G18R probably benign Het
Olfr1047 A T 2: 86,228,473 L166* probably null Het
Pde8a T G 7: 81,282,992 M134R probably benign Het
Pmepa1 G A 2: 173,228,133 R210W probably damaging Het
Polr3gl A G 3: 96,578,546 F135L probably damaging Het
Sdr16c6 T A 4: 4,062,671 I216F probably damaging Het
Slc23a2 T C 2: 132,089,201 D126G probably benign Het
Snx13 A T 12: 35,119,793 Y579F probably benign Het
Vcan T C 13: 89,689,449 T1699A probably damaging Het
Other mutations in Abra
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01512:Abra APN 15 41866017 missense probably damaging 0.99
IGL02022:Abra APN 15 41869406 missense probably benign
IGL02370:Abra APN 15 41869244 missense probably damaging 1.00
IGL02406:Abra APN 15 41869187 missense probably damaging 1.00
R1860:Abra UTSW 15 41869034 missense probably damaging 1.00
R1861:Abra UTSW 15 41869034 missense probably damaging 1.00
R3718:Abra UTSW 15 41866293 missense probably benign
R4582:Abra UTSW 15 41869285 missense probably benign 0.16
R4621:Abra UTSW 15 41869224 missense probably benign 0.10
R4724:Abra UTSW 15 41865906 missense probably damaging 1.00
R5926:Abra UTSW 15 41866254 missense probably damaging 1.00
R6417:Abra UTSW 15 41866056 missense probably benign 0.01
R6649:Abra UTSW 15 41869233 missense probably benign
R7348:Abra UTSW 15 41866159 missense probably damaging 1.00
R7487:Abra UTSW 15 41869553 missense probably damaging 1.00
R7997:Abra UTSW 15 41866197 missense probably damaging 1.00
RF053:Abra UTSW 15 41866299 small deletion probably benign
Predicted Primers PCR Primer
(F):5'- TTTGGTCAGCTCAGACACC -3'
(R):5'- TCAATTTGGCCCGAGGTTGG -3'

Sequencing Primer
(F):5'- TCAGCTCAGACACCAGGTTG -3'
(R):5'- AAACAGGCCCAGGAGCCTG -3'
Posted On2014-11-11