Incidental Mutation 'R0299:Gin1'
ID24769
Institutional Source Beutler Lab
Gene Symbol Gin1
Ensembl Gene ENSMUSG00000026333
Gene Namegypsy retrotransposon integrase 1
Synonyms4930429M06, Zh2c2
MMRRC Submission 038513-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R0299 (G1)
Quality Score225
Status Validated
Chromosome1
Chromosomal Location97770172-97793709 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 97783016 bp
ZygosityHeterozygous
Amino Acid Change Serine to Arginine at position 141 (S141R)
Ref Sequence ENSEMBL: ENSMUSP00000108464 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000027571] [ENSMUST00000112842] [ENSMUST00000112844] [ENSMUST00000138142]
Predicted Effect probably benign
Transcript: ENSMUST00000027571
SMART Domains Protein: ENSMUSP00000027571
Gene: ENSMUSG00000026333

DomainStartEndE-ValueType
low complexity region 63 73 N/A INTRINSIC
SCOP:d1exqa_ 112 208 2e-5 SMART
low complexity region 254 264 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000112842
SMART Domains Protein: ENSMUSP00000108461
Gene: ENSMUSG00000026333

DomainStartEndE-ValueType
low complexity region 63 73 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000112844
AA Change: S141R

PolyPhen 2 Score 0.858 (Sensitivity: 0.83; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000108464
Gene: ENSMUSG00000026333
AA Change: S141R

DomainStartEndE-ValueType
low complexity region 63 73 N/A INTRINSIC
PDB:4IKF|B 84 289 3e-8 PDB
SCOP:d1exqa_ 145 297 4e-16 SMART
low complexity region 343 353 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000138142
AA Change: C77S

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
Predicted Effect probably benign
Transcript: ENSMUST00000189031
Meta Mutation Damage Score 0.2359 question?
Coding Region Coverage
  • 1x: 98.8%
  • 3x: 97.8%
  • 10x: 95.3%
  • 20x: 90.1%
Validation Efficiency 100% (61/61)
Allele List at MGI
Other mutations in this stock
Total: 62 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930503L19Rik G A 18: 70,469,482 Q87* probably null Het
4933427I04Rik A T 4: 123,860,822 R176S possibly damaging Het
A2ml1 T G 6: 128,553,232 probably benign Het
Abca13 G A 11: 9,298,076 E2608K probably benign Het
Acpp T C 9: 104,320,002 E146G probably damaging Het
Adcy8 T A 15: 64,716,166 D894V probably damaging Het
Ap4b1 T C 3: 103,809,946 M1T probably null Het
Arg2 A G 12: 79,147,612 D70G probably damaging Het
Atxn1 A G 13: 45,567,169 S417P probably damaging Het
Btbd10 A T 7: 113,329,878 S230T possibly damaging Het
Carmil1 T A 13: 24,082,020 N253I probably damaging Het
Celf6 C A 9: 59,602,878 T86K probably benign Het
Clec2h T C 6: 128,670,895 V69A probably damaging Het
Col15a1 A T 4: 47,262,950 D534V probably damaging Het
Col16a1 TCCCC TCCC 4: 130,058,318 probably null Het
Degs1 A T 1: 182,279,271 I141N probably damaging Het
Dnah1 C T 14: 31,276,158 G2574D probably damaging Het
Dnah8 T A 17: 30,715,509 F1489L possibly damaging Het
Dock10 T C 1: 80,536,929 R1424G probably damaging Het
Elp2 T C 18: 24,634,409 I716T probably benign Het
Frk T C 10: 34,484,371 probably null Het
Fshr C G 17: 89,009,285 S169T probably benign Het
Gm11596 G A 11: 99,792,944 P117S unknown Het
Gm6327 T C 16: 12,761,197 noncoding transcript Het
Hepacam2 A G 6: 3,476,121 L268P probably damaging Het
Hps6 G A 19: 46,004,232 V203M probably damaging Het
Hsd17b7 G A 1: 169,959,794 probably benign Het
Il18rap A T 1: 40,525,058 H112L probably benign Het
Il1r2 T A 1: 40,123,149 Y317* probably null Het
Ints8 C A 4: 11,246,097 V190L probably benign Het
Me2 A G 18: 73,770,673 S575P probably benign Het
Mecom A G 3: 29,980,411 L372P probably benign Het
Mss51 T A 14: 20,484,688 Q338L possibly damaging Het
Muc2 C T 7: 141,752,729 T296I probably damaging Het
Muc4 A T 16: 32,750,195 probably benign Het
Neto1 G A 18: 86,461,320 R211Q probably benign Het
Nisch A G 14: 31,171,924 Y1231H probably damaging Het
Olfr1331 A G 4: 118,869,416 I212V probably benign Het
Olfr1338 A T 4: 118,754,535 M1K probably null Het
Pcsk6 T C 7: 66,039,043 V820A probably benign Het
Pdcd10 T C 3: 75,527,651 K111R probably damaging Het
Pdgfrb T A 18: 61,068,852 V496E probably benign Het
Pelo A T 13: 115,088,903 C40* probably null Het
Plxnc1 C T 10: 94,849,821 probably null Het
Ptpru G A 4: 131,803,387 Q519* probably null Het
Pzp A G 6: 128,495,330 probably benign Het
Rad21 A T 15: 51,965,030 D547E probably benign Het
Serpina1d A T 12: 103,765,757 L281Q probably damaging Het
Serpina9 T C 12: 104,001,470 N222S probably benign Het
Sh3bgrl2 A G 9: 83,577,559 K57E probably damaging Het
Shtn1 T C 19: 59,018,951 E289G probably benign Het
Sik3 T C 9: 46,208,740 M659T possibly damaging Het
Slamf7 G A 1: 171,648,931 probably benign Het
Sppl3 T A 5: 115,088,994 probably benign Het
Suco G A 1: 161,853,810 T253I probably benign Het
Tecta T C 9: 42,352,063 D1409G probably damaging Het
Tram2 T C 1: 21,004,244 D238G probably damaging Het
Trpm3 T C 19: 22,986,873 M1244T possibly damaging Het
Trub1 A G 19: 57,483,625 T178A possibly damaging Het
Ugcg G C 4: 59,217,036 V187L possibly damaging Het
Vmn1r25 T A 6: 57,978,509 Q265L probably damaging Het
Zfp821 G T 8: 109,724,230 R285L probably damaging Het
Other mutations in Gin1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01479:Gin1 APN 1 97792372 missense possibly damaging 0.95
IGL01508:Gin1 APN 1 97777437 missense probably benign
IGL01874:Gin1 APN 1 97783072 missense probably damaging 1.00
R0136:Gin1 UTSW 1 97783016 missense possibly damaging 0.86
R1302:Gin1 UTSW 1 97775589 nonsense probably null
R1607:Gin1 UTSW 1 97786150 missense probably damaging 1.00
R1675:Gin1 UTSW 1 97786055 nonsense probably null
R1739:Gin1 UTSW 1 97786104 missense probably damaging 0.99
R1769:Gin1 UTSW 1 97792437 missense probably benign 0.02
R1817:Gin1 UTSW 1 97785226 splice site probably null
R1818:Gin1 UTSW 1 97785226 splice site probably null
R1819:Gin1 UTSW 1 97785226 splice site probably null
R1907:Gin1 UTSW 1 97775447 unclassified probably benign
R2325:Gin1 UTSW 1 97792561 missense probably damaging 1.00
R4206:Gin1 UTSW 1 97792420 missense possibly damaging 0.90
R4571:Gin1 UTSW 1 97785076 missense probably damaging 1.00
R4576:Gin1 UTSW 1 97792339 missense probably damaging 1.00
R4670:Gin1 UTSW 1 97784840 missense probably damaging 1.00
R4671:Gin1 UTSW 1 97784840 missense probably damaging 1.00
R5659:Gin1 UTSW 1 97775532 missense possibly damaging 0.95
R6360:Gin1 UTSW 1 97792539 missense possibly damaging 0.90
R7035:Gin1 UTSW 1 97792375 missense possibly damaging 0.92
R7229:Gin1 UTSW 1 97785151 missense probably benign 0.02
Predicted Primers PCR Primer
(F):5'- CCGTCGTTTAGTCCAAGTAGCAGG -3'
(R):5'- GACACTGAAAGAGTGATACATGCTCCC -3'

Sequencing Primer
(F):5'- TGGACTTACTAGCTGCACAG -3'
(R):5'- TACATGCTCCCGAATGTGAG -3'
Posted On2013-04-16