Incidental Mutation 'R2386:Fgfr4'
ID247710
Institutional Source Beutler Lab
Gene Symbol Fgfr4
Ensembl Gene ENSMUSG00000005320
Gene Namefibroblast growth factor receptor 4
SynonymsFgfr-4
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R2386 (G1)
Quality Score225
Status Not validated
Chromosome13
Chromosomal Location55152640-55168759 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 55167901 bp
ZygosityHeterozygous
Amino Acid Change Valine to Alanine at position 747 (V747A)
Ref Sequence ENSEMBL: ENSMUSP00000005452 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000005452]
Predicted Effect probably benign
Transcript: ENSMUST00000005452
AA Change: V747A

PolyPhen 2 Score 0.360 (Sensitivity: 0.90; Specificity: 0.89)
SMART Domains Protein: ENSMUSP00000005452
Gene: ENSMUSG00000005320
AA Change: V747A

DomainStartEndE-ValueType
signal peptide 1 16 N/A INTRINSIC
IGc2 45 105 1.39e-11 SMART
IGc2 160 228 3.1e-18 SMART
IGc2 259 337 1.59e-6 SMART
low complexity region 369 387 N/A INTRINSIC
low complexity region 416 446 N/A INTRINSIC
TyrKc 464 740 1.67e-148 SMART
low complexity region 764 795 N/A INTRINSIC
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.4%
  • 10x: 96.7%
  • 20x: 92.7%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a member of the fibroblast growth factor receptor family, where amino acid sequence is highly conserved between members and throughout evolution. FGFR family members differ from one another in their ligand affinities and tissue distribution. A full-length representative protein would consist of an extracellular region, composed of three immunoglobulin-like domains, a single hydrophobic membrane-spanning segment and a cytoplasmic tyrosine kinase domain. The extracellular portion of the protein interacts with fibroblast growth factors, setting in motion a cascade of downstream signals, ultimately influencing mitogenesis and differentiation. The genomic organization of this gene, compared to members 1-3, encompasses 18 exons rather than 19 or 20. Although alternative splicing has been observed, there is no evidence that the C-terminal half of the IgIII domain of this protein varies between three alternate forms, as indicated for members 1-3. This particular family member preferentially binds acidic fibroblast growth factor and, although its specific function is unknown, it is overexpressed in gynecological tumor samples, suggesting a role in breast and ovarian tumorigenesis. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygotes for a targeted mutation are viable, healthy and overtly normal, except for a 10% weight reduction at weaning. Mice doubly homozygous for disruptions of Fgfr3 and Fgfr4 show novel phenotypes not seen in either single mutant, including dwarfismand defective respiratory alveogenesis. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 22 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700020L24Rik A G 11: 83,437,749 D2G probably damaging Het
Btnl9 A G 11: 49,178,775 S226P probably damaging Het
Canx A T 11: 50,297,106 D558E probably benign Het
Cd248 G T 19: 5,069,193 M356I possibly damaging Het
Col1a1 A T 11: 94,950,391 D1200V unknown Het
Dgat2 A C 7: 99,157,093 V299G possibly damaging Het
Ercc6 G A 14: 32,541,359 probably null Het
Ftcd A C 10: 76,581,377 D240A probably damaging Het
Hs3st3b1 C A 11: 63,889,213 E363* probably null Het
Ikbke A G 1: 131,259,266 L563P probably damaging Het
Lbhd2 A T 12: 111,410,307 T63S possibly damaging Het
Mterf1a A T 5: 3,891,225 D214E probably benign Het
Olfr473 A G 7: 107,934,273 Y251C probably damaging Het
Pclo A G 5: 14,765,247 E4511G unknown Het
Pigs A G 11: 78,332,986 Y108C probably damaging Het
Pkhd1l1 A G 15: 44,528,178 T1547A probably benign Het
Pmepa1 G A 2: 173,228,133 R210W probably damaging Het
Rad54b T A 4: 11,597,874 M253K probably benign Het
Rrp12 T C 19: 41,871,284 D1080G probably benign Het
Sox6 A G 7: 115,597,505 Y298H probably damaging Het
Tdrd9 A T 12: 112,015,900 D475V probably damaging Het
Tmem131 G A 1: 36,829,635 H370Y probably benign Het
Other mutations in Fgfr4
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00848:Fgfr4 APN 13 55159170 missense probably damaging 0.99
IGL02140:Fgfr4 APN 13 55161179 missense probably benign
IGL02817:Fgfr4 APN 13 55156668 critical splice donor site probably null
Modest UTSW 13 55166251 missense probably damaging 1.00
R0153:Fgfr4 UTSW 13 55161385 splice site probably benign
R0727:Fgfr4 UTSW 13 55156228 splice site probably null
R1646:Fgfr4 UTSW 13 55165964 missense probably damaging 1.00
R1749:Fgfr4 UTSW 13 55167792 splice site probably null
R1993:Fgfr4 UTSW 13 55165902 missense probably damaging 1.00
R2037:Fgfr4 UTSW 13 55167889 missense possibly damaging 0.51
R2152:Fgfr4 UTSW 13 55166964 missense probably damaging 1.00
R3086:Fgfr4 UTSW 13 55167392 splice site probably benign
R3939:Fgfr4 UTSW 13 55156494 missense probably null 0.96
R4255:Fgfr4 UTSW 13 55166251 missense probably damaging 1.00
R4463:Fgfr4 UTSW 13 55156467 missense probably benign 0.02
R4510:Fgfr4 UTSW 13 55161515 missense possibly damaging 0.81
R4511:Fgfr4 UTSW 13 55161515 missense possibly damaging 0.81
R4852:Fgfr4 UTSW 13 55161156 missense possibly damaging 0.68
R4932:Fgfr4 UTSW 13 55168170 missense unknown
R5133:Fgfr4 UTSW 13 55160015 missense probably damaging 1.00
R5146:Fgfr4 UTSW 13 55165912 missense probably damaging 1.00
R5380:Fgfr4 UTSW 13 55167417 missense probably damaging 1.00
R5431:Fgfr4 UTSW 13 55156651 missense probably benign
R5927:Fgfr4 UTSW 13 55166887 missense probably damaging 1.00
R6318:Fgfr4 UTSW 13 55166108 missense probably damaging 1.00
R6792:Fgfr4 UTSW 13 55156898 missense possibly damaging 0.65
R7018:Fgfr4 UTSW 13 55166200 missense probably damaging 0.98
R7290:Fgfr4 UTSW 13 55161449 missense probably benign 0.00
R7343:Fgfr4 UTSW 13 55159155 missense probably damaging 1.00
R7808:Fgfr4 UTSW 13 55161156 missense possibly damaging 0.68
R7891:Fgfr4 UTSW 13 55159151 missense probably benign 0.22
R7974:Fgfr4 UTSW 13 55159151 missense probably benign 0.22
Z1177:Fgfr4 UTSW 13 55161707 missense probably damaging 1.00
Z1177:Fgfr4 UTSW 13 55165929 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TTGACGTCAGCTTTTGGCCC -3'
(R):5'- GCTGAAAACCGAGTCACTGG -3'

Sequencing Primer
(F):5'- ACTAAACTGCCCTGCGC -3'
(R):5'- TGCTGGCATCCCCATTGG -3'
Posted On2014-11-11