Incidental Mutation 'R2389:Spag17'
ID 247726
Institutional Source Beutler Lab
Gene Symbol Spag17
Ensembl Gene ENSMUSG00000027867
Gene Name sperm associated antigen 17
Synonyms PF6, 4931427F14Rik
Accession Numbers
Essential gene? Non essential (E-score: 0.000) question?
Stock # R2389 (G1)
Quality Score 225
Status Not validated
Chromosome 3
Chromosomal Location 99792722-100050638 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) A to G at 100014153 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Tyrosine to Cysteine at position 2142 (Y2142C)
Ref Sequence ENSEMBL: ENSMUSP00000134066 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000164539]
AlphaFold Q5S003
Predicted Effect noncoding transcript
Transcript: ENSMUST00000137776
Predicted Effect noncoding transcript
Transcript: ENSMUST00000145279
Predicted Effect probably benign
Transcript: ENSMUST00000164539
AA Change: Y2142C

PolyPhen 2 Score 0.266 (Sensitivity: 0.91; Specificity: 0.88)
SMART Domains Protein: ENSMUSP00000134066
Gene: ENSMUSG00000027867
AA Change: Y2142C

DomainStartEndE-ValueType
low complexity region 155 170 N/A INTRINSIC
low complexity region 384 400 N/A INTRINSIC
low complexity region 876 887 N/A INTRINSIC
coiled coil region 909 964 N/A INTRINSIC
coiled coil region 1079 1120 N/A INTRINSIC
low complexity region 1179 1190 N/A INTRINSIC
low complexity region 1192 1205 N/A INTRINSIC
low complexity region 1209 1220 N/A INTRINSIC
low complexity region 1223 1238 N/A INTRINSIC
low complexity region 1394 1405 N/A INTRINSIC
low complexity region 1931 1942 N/A INTRINSIC
Pfam:PapD-like 2171 2277 1.2e-15 PFAM
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.5%
  • 10x: 96.9%
  • 20x: 93.8%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a central pair protein present in the axonemes of cells with a "9 + 2" organization of microtubules. The encoded protein is required for the proper function of the axoneme. Mutations in the orthologous gene in mice lead to primary ciliary dyskinesia characterized by immotile nasal and tracheal cilia, reduced clearance of nasal mucus, profound respiratory distress, hydrocephalus, and neonatal lethality within twelve hours of birth due to impaired airway mucociliary clearance. Single-nucleotide polymorphisms in this gene are associated with human height and targeted mutations lead to skeletal malformations affecting the limbs in mice, suggesting a role for this gene in skeletal development. [provided by RefSeq, Feb 2017]
PHENOTYPE: Homozygous null mice exhibit immotile respiratory cilia with axoneme structural defects, impaired mucociliary clearance, respiratory distress, pulmonary edema, disrupted alveolar epithelium, enlarged brain ventricles consistent with evolving hydrocephalus, failure to suckle, and neonatal lethality. [provided by MGI curators]
Allele List at MGI

All alleles(1) : Targeted, other(1)

Other mutations in this stock
Total: 25 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Actr5 T C 2: 158,467,132 (GRCm39) V24A probably benign Het
Adrm1 C A 2: 179,816,116 (GRCm39) probably benign Het
Cdk13 T A 13: 17,926,361 (GRCm39) H813L probably damaging Het
Cdkal1 T A 13: 29,736,219 (GRCm39) H300L probably damaging Het
Cnksr1 T C 4: 133,961,057 (GRCm39) I235V probably benign Het
Ctnnd1 T A 2: 84,454,615 (GRCm39) Q11L probably null Het
Dync2h1 T C 9: 7,122,618 (GRCm39) I2113V possibly damaging Het
Eng T C 2: 32,547,684 (GRCm39) probably null Het
Gria2 A G 3: 80,609,932 (GRCm39) W626R probably damaging Het
Kctd1 A G 18: 15,195,268 (GRCm39) S452P possibly damaging Het
Kdm4c T C 4: 74,252,107 (GRCm39) probably null Het
Kntc1 C T 5: 123,919,255 (GRCm39) L845F probably damaging Het
Lmf1 G A 17: 25,873,445 (GRCm39) V317M probably damaging Het
Nat8f7 C A 6: 85,684,476 (GRCm39) M121I probably benign Het
Ppfibp1 A T 6: 146,923,669 (GRCm39) H667L probably damaging Het
Pramel31 T A 4: 144,089,983 (GRCm39) L341H probably damaging Het
Prss12 A G 3: 123,280,670 (GRCm39) N452D possibly damaging Het
Rab17 T C 1: 90,891,926 (GRCm39) T33A probably benign Het
Rxfp3 A G 15: 11,036,770 (GRCm39) C201R probably damaging Het
Stx6 T C 1: 155,073,164 (GRCm39) V225A possibly damaging Het
Ugt2b5 G A 5: 87,275,541 (GRCm39) P437S probably damaging Het
Usp13 A G 3: 32,959,613 (GRCm39) K568R probably benign Het
Zan A G 5: 137,474,642 (GRCm39) probably null Het
Zbtb8b T C 4: 129,327,066 (GRCm39) E33G probably benign Het
Zcchc17 T A 4: 130,220,997 (GRCm39) K185* probably null Het
Other mutations in Spag17
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01096:Spag17 APN 3 99,970,691 (GRCm39) missense probably benign 0.00
IGL01143:Spag17 APN 3 99,846,614 (GRCm39) missense probably benign 0.00
IGL01329:Spag17 APN 3 100,002,865 (GRCm39) missense probably benign 0.16
IGL01393:Spag17 APN 3 99,934,926 (GRCm39) missense possibly damaging 0.53
IGL01617:Spag17 APN 3 100,016,824 (GRCm39) missense possibly damaging 0.65
IGL01705:Spag17 APN 3 99,930,046 (GRCm39) missense probably benign 0.01
IGL01928:Spag17 APN 3 99,847,390 (GRCm39) splice site probably benign
IGL01981:Spag17 APN 3 99,966,149 (GRCm39) missense probably benign 0.03
IGL02435:Spag17 APN 3 99,889,760 (GRCm39) missense possibly damaging 0.53
IGL02452:Spag17 APN 3 99,934,707 (GRCm39) missense probably benign 0.00
IGL02465:Spag17 APN 3 99,983,187 (GRCm39) missense probably damaging 0.96
IGL02615:Spag17 APN 3 99,979,401 (GRCm39) missense probably benign 0.09
IGL02751:Spag17 APN 3 99,918,110 (GRCm39) nonsense probably null
IGL02803:Spag17 APN 3 100,016,713 (GRCm39) missense probably benign
IGL02898:Spag17 APN 3 100,008,702 (GRCm39) missense probably benign 0.00
IGL03037:Spag17 APN 3 99,979,486 (GRCm39) splice site probably null
IGL03068:Spag17 APN 3 99,987,521 (GRCm39) missense probably benign 0.35
IGL03131:Spag17 APN 3 99,918,075 (GRCm39) missense possibly damaging 0.85
IGL03224:Spag17 APN 3 99,918,156 (GRCm39) missense possibly damaging 0.53
FR4342:Spag17 UTSW 3 99,963,568 (GRCm39) small insertion probably benign
FR4342:Spag17 UTSW 3 99,963,565 (GRCm39) small insertion probably benign
FR4548:Spag17 UTSW 3 99,963,570 (GRCm39) small insertion probably benign
FR4589:Spag17 UTSW 3 99,963,574 (GRCm39) small insertion probably benign
FR4589:Spag17 UTSW 3 99,963,561 (GRCm39) small insertion probably benign
FR4737:Spag17 UTSW 3 99,963,573 (GRCm39) small insertion probably benign
FR4976:Spag17 UTSW 3 99,963,571 (GRCm39) small insertion probably benign
FR4976:Spag17 UTSW 3 99,963,570 (GRCm39) small insertion probably benign
N/A:Spag17 UTSW 3 99,889,570 (GRCm39) splice site probably benign
PIT4504001:Spag17 UTSW 3 100,010,426 (GRCm39) critical splice acceptor site probably null
PIT4514001:Spag17 UTSW 3 99,920,527 (GRCm39) missense possibly damaging 0.53
R0107:Spag17 UTSW 3 99,958,103 (GRCm39) missense possibly damaging 0.72
R0230:Spag17 UTSW 3 100,014,143 (GRCm39) missense probably benign 0.08
R0243:Spag17 UTSW 3 99,992,684 (GRCm39) missense probably benign 0.04
R0321:Spag17 UTSW 3 100,008,719 (GRCm39) missense probably damaging 0.99
R0375:Spag17 UTSW 3 99,934,906 (GRCm39) missense probably benign
R0417:Spag17 UTSW 3 99,972,870 (GRCm39) missense probably benign 0.11
R0490:Spag17 UTSW 3 99,889,727 (GRCm39) missense probably damaging 0.97
R0537:Spag17 UTSW 3 100,032,618 (GRCm39) missense probably damaging 0.98
R0714:Spag17 UTSW 3 99,987,472 (GRCm39) missense probably damaging 0.97
R0844:Spag17 UTSW 3 99,912,101 (GRCm39) missense probably benign
R0919:Spag17 UTSW 3 99,979,259 (GRCm39) splice site probably benign
R0926:Spag17 UTSW 3 99,979,432 (GRCm39) missense probably benign
R1037:Spag17 UTSW 3 100,010,433 (GRCm39) missense probably benign 0.01
R1075:Spag17 UTSW 3 100,000,992 (GRCm39) missense probably damaging 0.99
R1109:Spag17 UTSW 3 99,934,667 (GRCm39) missense possibly damaging 0.86
R1213:Spag17 UTSW 3 100,002,954 (GRCm39) missense probably benign 0.01
R1221:Spag17 UTSW 3 99,889,584 (GRCm39) missense possibly damaging 0.72
R1576:Spag17 UTSW 3 99,846,679 (GRCm39) missense possibly damaging 0.73
R1586:Spag17 UTSW 3 99,929,068 (GRCm39) missense possibly damaging 0.53
R1768:Spag17 UTSW 3 99,934,668 (GRCm39) missense possibly damaging 0.53
R1782:Spag17 UTSW 3 99,918,070 (GRCm39) missense probably benign 0.02
R1789:Spag17 UTSW 3 99,846,672 (GRCm39) missense possibly damaging 0.73
R1945:Spag17 UTSW 3 99,847,298 (GRCm39) missense probably benign
R2065:Spag17 UTSW 3 99,920,524 (GRCm39) missense probably benign 0.03
R2118:Spag17 UTSW 3 99,956,556 (GRCm39) missense possibly damaging 0.72
R2265:Spag17 UTSW 3 99,969,182 (GRCm39) splice site probably null
R2266:Spag17 UTSW 3 99,969,182 (GRCm39) splice site probably null
R2267:Spag17 UTSW 3 99,969,182 (GRCm39) splice site probably null
R2268:Spag17 UTSW 3 99,969,182 (GRCm39) splice site probably null
R2271:Spag17 UTSW 3 100,014,113 (GRCm39) missense probably damaging 1.00
R2420:Spag17 UTSW 3 99,934,935 (GRCm39) missense probably benign
R2422:Spag17 UTSW 3 99,934,935 (GRCm39) missense probably benign
R2423:Spag17 UTSW 3 100,010,772 (GRCm39) missense probably benign
R3407:Spag17 UTSW 3 99,992,615 (GRCm39) missense probably benign 0.09
R3801:Spag17 UTSW 3 99,961,169 (GRCm39) missense possibly damaging 0.53
R3856:Spag17 UTSW 3 100,014,075 (GRCm39) missense probably damaging 1.00
R4021:Spag17 UTSW 3 99,956,546 (GRCm39) missense probably benign 0.00
R4022:Spag17 UTSW 3 99,956,546 (GRCm39) missense probably benign 0.00
R4408:Spag17 UTSW 3 100,010,694 (GRCm39) missense probably benign
R4468:Spag17 UTSW 3 99,992,682 (GRCm39) missense probably damaging 0.98
R4540:Spag17 UTSW 3 99,995,697 (GRCm39) missense probably damaging 1.00
R4621:Spag17 UTSW 3 100,010,559 (GRCm39) missense probably benign 0.08
R4622:Spag17 UTSW 3 100,010,559 (GRCm39) missense probably benign 0.08
R4756:Spag17 UTSW 3 100,010,701 (GRCm39) missense possibly damaging 0.68
R4797:Spag17 UTSW 3 99,891,795 (GRCm39) missense possibly damaging 0.70
R4855:Spag17 UTSW 3 99,970,649 (GRCm39) missense probably benign 0.02
R4887:Spag17 UTSW 3 99,958,147 (GRCm39) missense probably damaging 1.00
R4962:Spag17 UTSW 3 99,934,939 (GRCm39) missense probably benign
R5030:Spag17 UTSW 3 99,992,657 (GRCm39) nonsense probably null
R5042:Spag17 UTSW 3 99,979,465 (GRCm39) missense probably damaging 1.00
R5074:Spag17 UTSW 3 99,987,434 (GRCm39) missense possibly damaging 0.94
R5195:Spag17 UTSW 3 100,008,704 (GRCm39) missense probably benign 0.16
R5200:Spag17 UTSW 3 99,970,787 (GRCm39) nonsense probably null
R5267:Spag17 UTSW 3 99,969,264 (GRCm39) missense probably damaging 0.98
R5360:Spag17 UTSW 3 100,016,726 (GRCm39) missense probably benign 0.00
R5444:Spag17 UTSW 3 99,963,468 (GRCm39) missense probably benign 0.06
R5498:Spag17 UTSW 3 100,010,661 (GRCm39) missense possibly damaging 0.83
R5503:Spag17 UTSW 3 99,934,560 (GRCm39) missense possibly damaging 0.72
R5540:Spag17 UTSW 3 99,963,588 (GRCm39) missense possibly damaging 0.91
R5547:Spag17 UTSW 3 99,963,468 (GRCm39) missense probably benign 0.06
R5575:Spag17 UTSW 3 99,961,138 (GRCm39) missense possibly damaging 0.85
R5629:Spag17 UTSW 3 99,987,435 (GRCm39) missense probably benign 0.33
R5639:Spag17 UTSW 3 99,963,482 (GRCm39) missense probably damaging 1.00
R5842:Spag17 UTSW 3 99,846,566 (GRCm39) missense possibly damaging 0.85
R5976:Spag17 UTSW 3 100,003,107 (GRCm39) nonsense probably null
R6082:Spag17 UTSW 3 100,031,501 (GRCm39) missense possibly damaging 0.46
R6228:Spag17 UTSW 3 99,929,918 (GRCm39) missense probably benign 0.33
R6254:Spag17 UTSW 3 99,972,901 (GRCm39) missense probably benign 0.03
R6321:Spag17 UTSW 3 99,995,743 (GRCm39) missense probably benign 0.05
R6446:Spag17 UTSW 3 100,010,448 (GRCm39) missense probably benign
R6687:Spag17 UTSW 3 100,000,266 (GRCm39) missense probably benign 0.07
R6853:Spag17 UTSW 3 99,920,551 (GRCm39) missense possibly damaging 0.86
R6946:Spag17 UTSW 3 99,911,999 (GRCm39) missense possibly damaging 0.53
R6953:Spag17 UTSW 3 99,942,291 (GRCm39) missense possibly damaging 0.53
R7038:Spag17 UTSW 3 99,891,925 (GRCm39) missense probably benign 0.00
R7084:Spag17 UTSW 3 99,846,586 (GRCm39) missense probably benign 0.18
R7126:Spag17 UTSW 3 100,008,751 (GRCm39) missense probably benign 0.00
R7144:Spag17 UTSW 3 99,934,717 (GRCm39) splice site probably null
R7198:Spag17 UTSW 3 100,002,888 (GRCm39) missense probably benign 0.02
R7318:Spag17 UTSW 3 99,847,299 (GRCm39) missense probably benign 0.00
R7403:Spag17 UTSW 3 99,846,691 (GRCm39) missense possibly damaging 0.53
R7409:Spag17 UTSW 3 99,934,547 (GRCm39) missense possibly damaging 0.73
R7409:Spag17 UTSW 3 99,941,475 (GRCm39) missense probably benign 0.00
R7537:Spag17 UTSW 3 99,846,563 (GRCm39) missense possibly damaging 0.96
R7609:Spag17 UTSW 3 100,002,911 (GRCm39) nonsense probably null
R7772:Spag17 UTSW 3 99,987,434 (GRCm39) missense probably damaging 0.98
R7842:Spag17 UTSW 3 99,961,174 (GRCm39) missense probably benign 0.18
R7963:Spag17 UTSW 3 99,929,954 (GRCm39) missense probably benign 0.02
R8168:Spag17 UTSW 3 99,942,300 (GRCm39) missense possibly damaging 0.96
R8291:Spag17 UTSW 3 99,968,166 (GRCm39) missense probably benign
R8347:Spag17 UTSW 3 99,934,957 (GRCm39) missense probably benign
R8383:Spag17 UTSW 3 99,992,708 (GRCm39) missense probably damaging 0.98
R8474:Spag17 UTSW 3 99,934,586 (GRCm39) missense probably benign 0.00
R8528:Spag17 UTSW 3 100,031,501 (GRCm39) missense possibly damaging 0.46
R8804:Spag17 UTSW 3 99,874,506 (GRCm39) missense probably benign
R8809:Spag17 UTSW 3 99,889,738 (GRCm39) missense probably benign 0.33
R8818:Spag17 UTSW 3 99,920,543 (GRCm39) missense probably benign 0.02
R8830:Spag17 UTSW 3 100,032,751 (GRCm39) missense possibly damaging 0.77
R8890:Spag17 UTSW 3 99,911,994 (GRCm39) missense possibly damaging 0.73
R9008:Spag17 UTSW 3 99,934,942 (GRCm39) missense possibly damaging 0.73
R9095:Spag17 UTSW 3 99,912,092 (GRCm39) missense possibly damaging 0.86
R9143:Spag17 UTSW 3 99,934,906 (GRCm39) missense probably benign
R9182:Spag17 UTSW 3 99,966,158 (GRCm39) missense possibly damaging 0.92
R9211:Spag17 UTSW 3 100,032,614 (GRCm39) critical splice acceptor site probably benign
R9344:Spag17 UTSW 3 100,010,793 (GRCm39) missense probably benign 0.01
R9354:Spag17 UTSW 3 99,934,905 (GRCm39) missense probably benign
R9527:Spag17 UTSW 3 99,970,777 (GRCm39) missense probably damaging 1.00
R9658:Spag17 UTSW 3 99,934,932 (GRCm39) missense possibly damaging 0.93
R9738:Spag17 UTSW 3 99,934,526 (GRCm39) missense possibly damaging 0.53
X0025:Spag17 UTSW 3 100,008,767 (GRCm39) missense probably benign 0.31
Z1088:Spag17 UTSW 3 100,002,946 (GRCm39) missense probably benign 0.09
Z1176:Spag17 UTSW 3 99,920,309 (GRCm39) missense probably benign 0.18
Z1177:Spag17 UTSW 3 99,995,715 (GRCm39) missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- AGAAAGTTTCCAGGCTGGTTC -3'
(R):5'- ATCTCAGAAGCTGGTGCCAG -3'

Sequencing Primer
(F):5'- GGCTGGTTCATGCACTTCTATGAAC -3'
(R):5'- CCAGCCAGTGGGAGCAGAG -3'
Posted On 2014-11-11