Incidental Mutation 'R0299:Pdcd10'
ID24773
Institutional Source Beutler Lab
Gene Symbol Pdcd10
Ensembl Gene ENSMUSG00000027835
Gene Nameprogrammed cell death 10
SynonymsTfa15, TF-1 cell apoptosis related protein-15, 2410003B13Rik, CCM3
MMRRC Submission 038513-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R0299 (G1)
Quality Score165
Status Validated
Chromosome3
Chromosomal Location75516490-75556856 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 75527651 bp
ZygosityHeterozygous
Amino Acid Change Lysine to Arginine at position 111 (K111R)
Ref Sequence ENSEMBL: ENSMUSP00000125752 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000029424] [ENSMUST00000161137] [ENSMUST00000162138]
Predicted Effect probably damaging
Transcript: ENSMUST00000029424
AA Change: K48R

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000029424
Gene: ENSMUSG00000027835
AA Change: K48R

DomainStartEndE-ValueType
Pfam:DUF1241 1 99 1.7e-46 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000161137
AA Change: K111R

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000125752
Gene: ENSMUSG00000027835
AA Change: K111R

DomainStartEndE-ValueType
Pfam:DUF1241 14 161 1.7e-66 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000162138
SMART Domains Protein: ENSMUSP00000124421
Gene: ENSMUSG00000027835

DomainStartEndE-ValueType
Pfam:DUF1241 10 66 5.4e-21 PFAM
Meta Mutation Damage Score 0.4796 question?
Coding Region Coverage
  • 1x: 98.8%
  • 3x: 97.8%
  • 10x: 95.3%
  • 20x: 90.1%
Validation Efficiency 100% (61/61)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes an evolutionarily conserved protein associated with cell apoptosis. The protein interacts with the serine/threonine protein kinase MST4 to modulate the extracellular signal-regulated kinase (ERK) pathway. It also interacts with and is phosphoryated by serine/threonine kinase 25, and is thought to function in a signaling pathway essential for vascular developent. Mutations in this gene are one cause of cerebral cavernous malformations, which are vascular malformations that cause seizures and cerebral hemorrhages. Multiple alternatively spliced variants, encoding the same protein, have been identified. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygous knockout is embryonic lethal due to impaired hematopoeisis, vasculogenesis, and abnormal heart morphology. Conditional knockout in myeloids increases degranulation of, and exocytosis by, neutrophils. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 62 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930503L19Rik G A 18: 70,469,482 Q87* probably null Het
4933427I04Rik A T 4: 123,860,822 R176S possibly damaging Het
A2ml1 T G 6: 128,553,232 probably benign Het
Abca13 G A 11: 9,298,076 E2608K probably benign Het
Acpp T C 9: 104,320,002 E146G probably damaging Het
Adcy8 T A 15: 64,716,166 D894V probably damaging Het
Ap4b1 T C 3: 103,809,946 M1T probably null Het
Arg2 A G 12: 79,147,612 D70G probably damaging Het
Atxn1 A G 13: 45,567,169 S417P probably damaging Het
Btbd10 A T 7: 113,329,878 S230T possibly damaging Het
Carmil1 T A 13: 24,082,020 N253I probably damaging Het
Celf6 C A 9: 59,602,878 T86K probably benign Het
Clec2h T C 6: 128,670,895 V69A probably damaging Het
Col15a1 A T 4: 47,262,950 D534V probably damaging Het
Col16a1 TCCCC TCCC 4: 130,058,318 probably null Het
Degs1 A T 1: 182,279,271 I141N probably damaging Het
Dnah1 C T 14: 31,276,158 G2574D probably damaging Het
Dnah8 T A 17: 30,715,509 F1489L possibly damaging Het
Dock10 T C 1: 80,536,929 R1424G probably damaging Het
Elp2 T C 18: 24,634,409 I716T probably benign Het
Frk T C 10: 34,484,371 probably null Het
Fshr C G 17: 89,009,285 S169T probably benign Het
Gin1 T A 1: 97,783,016 S141R possibly damaging Het
Gm11596 G A 11: 99,792,944 P117S unknown Het
Gm6327 T C 16: 12,761,197 noncoding transcript Het
Hepacam2 A G 6: 3,476,121 L268P probably damaging Het
Hps6 G A 19: 46,004,232 V203M probably damaging Het
Hsd17b7 G A 1: 169,959,794 probably benign Het
Il18rap A T 1: 40,525,058 H112L probably benign Het
Il1r2 T A 1: 40,123,149 Y317* probably null Het
Ints8 C A 4: 11,246,097 V190L probably benign Het
Me2 A G 18: 73,770,673 S575P probably benign Het
Mecom A G 3: 29,980,411 L372P probably benign Het
Mss51 T A 14: 20,484,688 Q338L possibly damaging Het
Muc2 C T 7: 141,752,729 T296I probably damaging Het
Muc4 A T 16: 32,750,195 probably benign Het
Neto1 G A 18: 86,461,320 R211Q probably benign Het
Nisch A G 14: 31,171,924 Y1231H probably damaging Het
Olfr1331 A G 4: 118,869,416 I212V probably benign Het
Olfr1338 A T 4: 118,754,535 M1K probably null Het
Pcsk6 T C 7: 66,039,043 V820A probably benign Het
Pdgfrb T A 18: 61,068,852 V496E probably benign Het
Pelo A T 13: 115,088,903 C40* probably null Het
Plxnc1 C T 10: 94,849,821 probably null Het
Ptpru G A 4: 131,803,387 Q519* probably null Het
Pzp A G 6: 128,495,330 probably benign Het
Rad21 A T 15: 51,965,030 D547E probably benign Het
Serpina1d A T 12: 103,765,757 L281Q probably damaging Het
Serpina9 T C 12: 104,001,470 N222S probably benign Het
Sh3bgrl2 A G 9: 83,577,559 K57E probably damaging Het
Shtn1 T C 19: 59,018,951 E289G probably benign Het
Sik3 T C 9: 46,208,740 M659T possibly damaging Het
Slamf7 G A 1: 171,648,931 probably benign Het
Sppl3 T A 5: 115,088,994 probably benign Het
Suco G A 1: 161,853,810 T253I probably benign Het
Tecta T C 9: 42,352,063 D1409G probably damaging Het
Tram2 T C 1: 21,004,244 D238G probably damaging Het
Trpm3 T C 19: 22,986,873 M1244T possibly damaging Het
Trub1 A G 19: 57,483,625 T178A possibly damaging Het
Ugcg G C 4: 59,217,036 V187L possibly damaging Het
Vmn1r25 T A 6: 57,978,509 Q265L probably damaging Het
Zfp821 G T 8: 109,724,230 R285L probably damaging Het
Other mutations in Pdcd10
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01154:Pdcd10 APN 3 75541233 missense probably damaging 0.98
IGL01545:Pdcd10 APN 3 75541168 missense possibly damaging 0.57
IGL02179:Pdcd10 APN 3 75527615 missense probably damaging 1.00
IGL02675:Pdcd10 APN 3 75527594 missense probably damaging 1.00
R0499:Pdcd10 UTSW 3 75527651 missense probably damaging 1.00
R1674:Pdcd10 UTSW 3 75541179 missense probably damaging 0.99
R4197:Pdcd10 UTSW 3 75517592 missense possibly damaging 0.77
R4615:Pdcd10 UTSW 3 75521091 missense probably damaging 1.00
R4908:Pdcd10 UTSW 3 75541246 missense probably damaging 0.98
R5469:Pdcd10 UTSW 3 75521057 nonsense probably null
R6628:Pdcd10 UTSW 3 75521071 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TGTTTAGTCCACTACGTCATTGGTGC -3'
(R):5'- ACTGGACCAAGTTGAACTTCGTTTCTC -3'

Sequencing Primer
(F):5'- CTCTGAGGCCATTATATTCAAAGTCC -3'
(R):5'- AAGTTGAACTTCGTTTCTCTTTTTG -3'
Posted On2013-04-16