Incidental Mutation 'R2389:Ugt2b5'
ID 247733
Institutional Source Beutler Lab
Gene Symbol Ugt2b5
Ensembl Gene ENSMUSG00000054630
Gene Name UDP glucuronosyltransferase 2 family, polypeptide B5
Synonyms Udpgt-3, m-1
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.055) question?
Stock # R2389 (G1)
Quality Score 225
Status Not validated
Chromosome 5
Chromosomal Location 87124960-87140318 bp(-) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) G to A at 87127682 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Proline to Serine at position 437 (P437S)
Ref Sequence ENSEMBL: ENSMUSP00000068282 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000067790]
AlphaFold no structure available at present
Predicted Effect probably damaging
Transcript: ENSMUST00000067790
AA Change: P437S

PolyPhen 2 Score 0.983 (Sensitivity: 0.75; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000068282
Gene: ENSMUSG00000054630
AA Change: P437S

DomainStartEndE-ValueType
signal peptide 1 23 N/A INTRINSIC
Pfam:UDPGT 24 527 7.9e-256 PFAM
Pfam:Glyco_tran_28_C 352 449 5.3e-8 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000113327
AA Change: P448S

PolyPhen 2 Score 0.983 (Sensitivity: 0.75; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000108953
Gene: ENSMUSG00000054630
AA Change: P448S

DomainStartEndE-ValueType
Pfam:UDPGT 35 538 1.3e-259 PFAM
Pfam:Glyco_tran_28_C 341 460 4.3e-8 PFAM
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.5%
  • 10x: 96.9%
  • 20x: 93.8%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 25 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Actr5 T C 2: 158,625,212 V24A probably benign Het
Adrm1 C A 2: 180,174,323 probably benign Het
Cdk13 T A 13: 17,751,776 H813L probably damaging Het
Cdkal1 T A 13: 29,552,236 H300L probably damaging Het
Cnksr1 T C 4: 134,233,746 I235V probably benign Het
Ctnnd1 T A 2: 84,624,271 Q11L probably null Het
Dync2h1 T C 9: 7,122,618 I2113V possibly damaging Het
Eng T C 2: 32,657,672 probably null Het
Gm13119 T A 4: 144,363,413 L341H probably damaging Het
Gria2 A G 3: 80,702,625 W626R probably damaging Het
Kctd1 A G 18: 15,062,211 S452P possibly damaging Het
Kdm4c T C 4: 74,333,870 probably null Het
Kntc1 C T 5: 123,781,192 L845F probably damaging Het
Lmf1 G A 17: 25,654,471 V317M probably damaging Het
Nat8f7 C A 6: 85,707,494 M121I probably benign Het
Ppfibp1 A T 6: 147,022,171 H667L probably damaging Het
Prss12 A G 3: 123,487,021 N452D possibly damaging Het
Rab17 T C 1: 90,964,204 T33A probably benign Het
Rxfp3 A G 15: 11,036,684 C201R probably damaging Het
Spag17 A G 3: 100,106,837 Y2142C probably benign Het
Stx6 T C 1: 155,197,418 V225A possibly damaging Het
Usp13 A G 3: 32,905,464 K568R probably benign Het
Zan A G 5: 137,476,380 probably null Het
Zbtb8b T C 4: 129,433,273 E33G probably benign Het
Zcchc17 T A 4: 130,327,204 K185* probably null Het
Other mutations in Ugt2b5
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00702:Ugt2b5 APN 5 87125219 missense probably benign 0.02
IGL00742:Ugt2b5 APN 5 87127814 missense probably damaging 1.00
IGL01527:Ugt2b5 APN 5 87136209 missense possibly damaging 0.71
IGL01530:Ugt2b5 APN 5 87137245 missense probably benign 0.08
IGL01637:Ugt2b5 APN 5 87139900 missense probably benign 0.04
IGL02371:Ugt2b5 APN 5 87127676 critical splice donor site probably null
IGL02993:Ugt2b5 APN 5 87137232 missense probably damaging 1.00
IGL03114:Ugt2b5 APN 5 87128350 missense probably damaging 1.00
R0372:Ugt2b5 UTSW 5 87140258 missense probably benign 0.05
R0568:Ugt2b5 UTSW 5 87137365 critical splice acceptor site probably benign
R0650:Ugt2b5 UTSW 5 87139768 missense probably benign 0.00
R1660:Ugt2b5 UTSW 5 87139618 missense probably benign 0.00
R1907:Ugt2b5 UTSW 5 87139630 missense probably benign 0.19
R1955:Ugt2b5 UTSW 5 87127772 missense probably benign 0.18
R2435:Ugt2b5 UTSW 5 87139606 missense probably damaging 0.99
R2919:Ugt2b5 UTSW 5 87125407 missense possibly damaging 0.83
R2920:Ugt2b5 UTSW 5 87125407 missense possibly damaging 0.83
R4342:Ugt2b5 UTSW 5 87139723 missense probably damaging 1.00
R4343:Ugt2b5 UTSW 5 87139723 missense probably damaging 1.00
R4344:Ugt2b5 UTSW 5 87139723 missense probably damaging 1.00
R4355:Ugt2b5 UTSW 5 87139763 nonsense probably null
R4380:Ugt2b5 UTSW 5 87127894 missense probably damaging 1.00
R4789:Ugt2b5 UTSW 5 87139691 missense probably benign 0.14
R4993:Ugt2b5 UTSW 5 87139673 missense probably benign 0.00
R5731:Ugt2b5 UTSW 5 87140252 nonsense probably null
R6035:Ugt2b5 UTSW 5 87139682 missense probably benign 0.09
R6035:Ugt2b5 UTSW 5 87139682 missense probably benign 0.09
R6491:Ugt2b5 UTSW 5 87125469 nonsense probably null
R7015:Ugt2b5 UTSW 5 87139796 missense probably damaging 1.00
R7203:Ugt2b5 UTSW 5 87128399 missense possibly damaging 0.72
R7212:Ugt2b5 UTSW 5 87125272 missense probably benign 0.06
R7750:Ugt2b5 UTSW 5 87140249 missense probably benign 0.11
R8384:Ugt2b5 UTSW 5 87140065 missense probably benign
R8465:Ugt2b5 UTSW 5 87139659 missense possibly damaging 0.79
R9336:Ugt2b5 UTSW 5 87137271 missense probably benign 0.00
X0004:Ugt2b5 UTSW 5 87128371 nonsense probably null
X0021:Ugt2b5 UTSW 5 87136211 missense possibly damaging 0.95
Predicted Primers PCR Primer
(F):5'- TAGTGAGGTAACCCAATCACAAAAG -3'
(R):5'- AGCCTTTGTAACTCATGGTGG -3'

Sequencing Primer
(F):5'- cccagaaacatagaacaacc -3'
(R):5'- GGGCCAATGGTGTCTACGAG -3'
Posted On 2014-11-11