Incidental Mutation 'R2391:Cdk18'
ID247751
Institutional Source Beutler Lab
Gene Symbol Cdk18
Ensembl Gene ENSMUSG00000026437
Gene Namecyclin-dependent kinase 18
SynonymsPctk3
MMRRC Submission 040359-MU
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.311) question?
Stock #R2391 (G1)
Quality Score225
Status Validated
Chromosome1
Chromosomal Location132112237-132139684 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to T at 132115474 bp
ZygosityHeterozygous
Amino Acid Change Glutamine to Lysine at position 438 (Q438K)
Ref Sequence ENSEMBL: ENSMUSP00000107981 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000027697] [ENSMUST00000112362] [ENSMUST00000185601]
Predicted Effect probably benign
Transcript: ENSMUST00000027697
AA Change: Q438K

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000027697
Gene: ENSMUSG00000026437
AA Change: Q438K

DomainStartEndE-ValueType
S_TKc 121 402 1.13e-95 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000112362
AA Change: Q438K

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000107981
Gene: ENSMUSG00000026437
AA Change: Q438K

DomainStartEndE-ValueType
S_TKc 121 402 1.13e-95 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000185601
SMART Domains Protein: ENSMUSP00000140034
Gene: ENSMUSG00000026437

DomainStartEndE-ValueType
Blast:S_TKc 1 34 6e-15 BLAST
PDB:3MTL|A 1 34 2e-8 PDB
Predicted Effect noncoding transcript
Transcript: ENSMUST00000188387
Predicted Effect noncoding transcript
Transcript: ENSMUST00000189733
Meta Mutation Damage Score 0.0673 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.5%
  • 10x: 97.0%
  • 20x: 94.2%
Validation Efficiency 100% (36/36)
Allele List at MGI
Other mutations in this stock
Total: 32 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1110004F10Rik T A 7: 116,104,226 D24E probably damaging Het
Abca4 A G 3: 122,158,422 H689R probably benign Het
Acss3 T G 10: 107,123,487 T33P probably benign Het
BC005537 T A 13: 24,809,915 Y124* probably null Het
Capn2 T C 1: 182,478,609 D524G probably benign Het
Catsperb A G 12: 101,624,706 Y1011C probably damaging Het
Ckap5 A G 2: 91,585,869 M1047V possibly damaging Het
Dab1 C T 4: 104,731,751 A524V probably benign Het
Dmbt1 T A 7: 131,106,468 I1306N probably damaging Het
Emp2 A T 16: 10,284,588 I120N probably damaging Het
Gm2888 A T 14: 3,037,656 D216V possibly damaging Het
Naa16 T A 14: 79,370,049 H287L probably benign Het
Odf3l2 A T 10: 79,645,650 V15E probably benign Het
Olfm5 A G 7: 104,160,834 S107P probably benign Het
Olfr1419 G T 19: 11,870,816 Y133* probably null Het
Olfr421-ps1 T C 1: 174,152,098 V194A probably benign Het
Olfr78 C A 7: 102,742,374 V210F possibly damaging Het
Ptpn2 A T 18: 67,675,889 probably null Het
Serpinb8 A G 1: 107,607,069 D290G probably damaging Het
Sfmbt2 T C 2: 10,445,693 Y260H possibly damaging Het
Slc6a20a A T 9: 123,664,621 V65E probably damaging Het
Spon1 C T 7: 113,886,847 T210M probably damaging Het
Sugp1 T C 8: 70,059,411 probably null Het
Tas2r143 C A 6: 42,400,876 H213Q probably damaging Het
Terf1 C A 1: 15,805,739 S21* probably null Het
Trim12a T C 7: 104,306,931 E134G probably damaging Het
Trip12 TATACATACATACATACATACATACATACATAC TATACATACATACATACATACATACATACATACATAC 1: 84,814,790 probably null Het
Tssk5 T C 15: 76,374,551 Y45C probably benign Het
Usp29 T A 7: 6,963,771 probably null Het
Wdfy4 A T 14: 33,162,807 M46K possibly damaging Het
Wdr90 G A 17: 25,851,455 P1104L probably damaging Het
Znhit6 T C 3: 145,594,658 S230P probably damaging Het
Other mutations in Cdk18
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00519:Cdk18 APN 1 132115488 missense probably benign 0.36
IGL00929:Cdk18 APN 1 132118519 critical splice donor site probably null
R0184:Cdk18 UTSW 1 132118538 missense probably benign 0.00
R0606:Cdk18 UTSW 1 132117617 unclassified probably benign
R0624:Cdk18 UTSW 1 132118872 missense probably damaging 1.00
R1295:Cdk18 UTSW 1 132119960 unclassified probably benign
R1296:Cdk18 UTSW 1 132119960 unclassified probably benign
R1298:Cdk18 UTSW 1 132122451 start gained probably benign
R1611:Cdk18 UTSW 1 132122375 missense probably damaging 1.00
R1959:Cdk18 UTSW 1 132117821 missense possibly damaging 0.95
R2184:Cdk18 UTSW 1 132115952 missense probably damaging 1.00
R2279:Cdk18 UTSW 1 132115952 missense probably damaging 1.00
R4601:Cdk18 UTSW 1 132116919 missense possibly damaging 0.95
R5001:Cdk18 UTSW 1 132118849 critical splice donor site probably null
R5208:Cdk18 UTSW 1 132117480 critical splice donor site probably null
R5818:Cdk18 UTSW 1 132119098 critical splice donor site probably null
R6282:Cdk18 UTSW 1 132120020 missense probably damaging 1.00
R6546:Cdk18 UTSW 1 132122350 missense probably damaging 0.99
R6644:Cdk18 UTSW 1 132122069 nonsense probably null
R6892:Cdk18 UTSW 1 132122110 missense probably benign 0.01
R6965:Cdk18 UTSW 1 132117581 missense probably damaging 0.98
R7698:Cdk18 UTSW 1 132122378 missense probably damaging 1.00
R7828:Cdk18 UTSW 1 132116904 missense possibly damaging 0.69
Predicted Primers PCR Primer
(F):5'- GGACTACTGTGAAAGGCTGTG -3'
(R):5'- TGGATCCCACCTGAGATGGTAG -3'

Sequencing Primer
(F):5'- CTACTGTGAAAGGCTGTGTTCCATC -3'
(R):5'- CACCTGAGATGGTAGATCTTCCAG -3'
Posted On2014-11-11