Incidental Mutation 'R2391:Tas2r143'
ID247759
Institutional Source Beutler Lab
Gene Symbol Tas2r143
Ensembl Gene ENSMUSG00000046652
Gene Nametaste receptor, type 2, member 143
Synonymsmt2r36, Tas2r43
MMRRC Submission 040359-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.050) question?
Stock #R2391 (G1)
Quality Score225
Status Validated
Chromosome6
Chromosomal Location42400238-42401119 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to A at 42400876 bp
ZygosityHeterozygous
Amino Acid Change Histidine to Glutamine at position 213 (H213Q)
Ref Sequence ENSEMBL: ENSMUSP00000057910 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000057398] [ENSMUST00000070178]
Predicted Effect probably damaging
Transcript: ENSMUST00000057398
AA Change: H213Q

PolyPhen 2 Score 0.988 (Sensitivity: 0.73; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000057910
Gene: ENSMUSG00000046652
AA Change: H213Q

DomainStartEndE-ValueType
Pfam:TAS2R 1 293 6.7e-68 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000070178
SMART Domains Protein: ENSMUSP00000070247
Gene: ENSMUSG00000056203

DomainStartEndE-ValueType
Pfam:TAS2R 22 320 1.3e-63 PFAM
Meta Mutation Damage Score 0.6467 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.5%
  • 10x: 97.0%
  • 20x: 94.2%
Validation Efficiency 100% (36/36)
Allele List at MGI
Other mutations in this stock
Total: 32 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1110004F10Rik T A 7: 116,104,226 D24E probably damaging Het
Abca4 A G 3: 122,158,422 H689R probably benign Het
Acss3 T G 10: 107,123,487 T33P probably benign Het
BC005537 T A 13: 24,809,915 Y124* probably null Het
Capn2 T C 1: 182,478,609 D524G probably benign Het
Catsperb A G 12: 101,624,706 Y1011C probably damaging Het
Cdk18 G T 1: 132,115,474 Q438K probably benign Het
Ckap5 A G 2: 91,585,869 M1047V possibly damaging Het
Dab1 C T 4: 104,731,751 A524V probably benign Het
Dmbt1 T A 7: 131,106,468 I1306N probably damaging Het
Emp2 A T 16: 10,284,588 I120N probably damaging Het
Gm2888 A T 14: 3,037,656 D216V possibly damaging Het
Naa16 T A 14: 79,370,049 H287L probably benign Het
Odf3l2 A T 10: 79,645,650 V15E probably benign Het
Olfm5 A G 7: 104,160,834 S107P probably benign Het
Olfr1419 G T 19: 11,870,816 Y133* probably null Het
Olfr421-ps1 T C 1: 174,152,098 V194A probably benign Het
Olfr78 C A 7: 102,742,374 V210F possibly damaging Het
Ptpn2 A T 18: 67,675,889 probably null Het
Serpinb8 A G 1: 107,607,069 D290G probably damaging Het
Sfmbt2 T C 2: 10,445,693 Y260H possibly damaging Het
Slc6a20a A T 9: 123,664,621 V65E probably damaging Het
Spon1 C T 7: 113,886,847 T210M probably damaging Het
Sugp1 T C 8: 70,059,411 probably null Het
Terf1 C A 1: 15,805,739 S21* probably null Het
Trim12a T C 7: 104,306,931 E134G probably damaging Het
Trip12 TATACATACATACATACATACATACATACATAC TATACATACATACATACATACATACATACATACATAC 1: 84,814,790 probably null Het
Tssk5 T C 15: 76,374,551 Y45C probably benign Het
Usp29 T A 7: 6,963,771 probably null Het
Wdfy4 A T 14: 33,162,807 M46K possibly damaging Het
Wdr90 G A 17: 25,851,455 P1104L probably damaging Het
Znhit6 T C 3: 145,594,658 S230P probably damaging Het
Other mutations in Tas2r143
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02216:Tas2r143 APN 6 42400334 nonsense probably null
IGL02832:Tas2r143 APN 6 42400325 missense possibly damaging 0.55
R0125:Tas2r143 UTSW 6 42400955 missense probably benign 0.01
R1035:Tas2r143 UTSW 6 42400265 missense probably benign 0.16
R1073:Tas2r143 UTSW 6 42400760 missense probably benign 0.01
R1400:Tas2r143 UTSW 6 42400383 missense probably benign 0.35
R1774:Tas2r143 UTSW 6 42400371 missense probably damaging 1.00
R3617:Tas2r143 UTSW 6 42401063 missense probably benign 0.20
R3693:Tas2r143 UTSW 6 42400976 missense probably benign 0.00
R4283:Tas2r143 UTSW 6 42401073 unclassified probably null
R4486:Tas2r143 UTSW 6 42400694 missense probably benign 0.15
R5005:Tas2r143 UTSW 6 42400724 missense probably benign 0.02
R6360:Tas2r143 UTSW 6 42400835 missense probably benign 0.40
R7163:Tas2r143 UTSW 6 42400268 missense probably benign
R7827:Tas2r143 UTSW 6 42400722 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- ATGACCATCTCCCAGGGTTTC -3'
(R):5'- TCAGTTTGGGGTTGCTAAACAG -3'

Sequencing Primer
(F):5'- CCATGGAAACTGCACTTTTGG -3'
(R):5'- GTTCAAAAAGATGCCTGTGTAGATG -3'
Posted On2014-11-11