Incidental Mutation 'R2391:Spon1'
ID 247763
Institutional Source Beutler Lab
Gene Symbol Spon1
Ensembl Gene ENSMUSG00000038156
Gene Name spondin 1, (f-spondin) extracellular matrix protein
Synonyms FSP, D330035F22Rik
MMRRC Submission 040359-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.239) question?
Stock # R2391 (G1)
Quality Score 225
Status Validated
Chromosome 7
Chromosomal Location 113765998-114043370 bp(+) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) C to T at 113886847 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Threonine to Methionine at position 210 (T210M)
Ref Sequence ENSEMBL: ENSMUSP00000081746 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000046687] [ENSMUST00000084696]
AlphaFold Q8VCC9
Predicted Effect probably damaging
Transcript: ENSMUST00000046687
AA Change: T210M

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000041157
Gene: ENSMUSG00000038156
AA Change: T210M

DomainStartEndE-ValueType
signal peptide 1 28 N/A INTRINSIC
Pfam:Reeler 44 172 1e-24 PFAM
Pfam:Spond_N 205 399 7.5e-74 PFAM
low complexity region 431 442 N/A INTRINSIC
TSP1 445 495 7.92e-8 SMART
TSP1 504 555 6.57e-14 SMART
TSP1 561 611 2.29e-13 SMART
TSP1 617 666 1.45e-15 SMART
TSP1 671 721 1.21e-12 SMART
low complexity region 730 747 N/A INTRINSIC
TSP1 757 806 3.12e-6 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000084696
AA Change: T210M

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000081746
Gene: ENSMUSG00000038156
AA Change: T210M

DomainStartEndE-ValueType
signal peptide 1 28 N/A INTRINSIC
Pfam:Reeler 43 173 1.5e-35 PFAM
Pfam:Spond_N 204 281 1.3e-31 PFAM
Meta Mutation Damage Score 0.6467 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.5%
  • 10x: 97.0%
  • 20x: 94.2%
Validation Efficiency 100% (36/36)
MGI Phenotype PHENOTYPE: Mice homozygous for a null allele display increased trabecular and cortical bone mass. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 32 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1110004F10Rik T A 7: 116,104,226 D24E probably damaging Het
Abca4 A G 3: 122,158,422 H689R probably benign Het
Acss3 T G 10: 107,123,487 T33P probably benign Het
BC005537 T A 13: 24,809,915 Y124* probably null Het
Capn2 T C 1: 182,478,609 D524G probably benign Het
Catsperb A G 12: 101,624,706 Y1011C probably damaging Het
Cdk18 G T 1: 132,115,474 Q438K probably benign Het
Ckap5 A G 2: 91,585,869 M1047V possibly damaging Het
Dab1 C T 4: 104,731,751 A524V probably benign Het
Dmbt1 T A 7: 131,106,468 I1306N probably damaging Het
Emp2 A T 16: 10,284,588 I120N probably damaging Het
Gm2888 A T 14: 3,037,656 D216V possibly damaging Het
Naa16 T A 14: 79,370,049 H287L probably benign Het
Odf3l2 A T 10: 79,645,650 V15E probably benign Het
Olfm5 A G 7: 104,160,834 S107P probably benign Het
Olfr1419 G T 19: 11,870,816 Y133* probably null Het
Olfr421-ps1 T C 1: 174,152,098 V194A probably benign Het
Olfr78 C A 7: 102,742,374 V210F possibly damaging Het
Ptpn2 A T 18: 67,675,889 probably null Het
Serpinb8 A G 1: 107,607,069 D290G probably damaging Het
Sfmbt2 T C 2: 10,445,693 Y260H possibly damaging Het
Slc6a20a A T 9: 123,664,621 V65E probably damaging Het
Sugp1 T C 8: 70,059,411 probably null Het
Tas2r143 C A 6: 42,400,876 H213Q probably damaging Het
Terf1 C A 1: 15,805,739 S21* probably null Het
Trim12a T C 7: 104,306,931 E134G probably damaging Het
Trip12 TATACATACATACATACATACATACATACATAC TATACATACATACATACATACATACATACATACATAC 1: 84,814,790 probably null Het
Tssk5 T C 15: 76,374,551 Y45C probably benign Het
Usp29 T A 7: 6,963,771 probably null Het
Wdfy4 A T 14: 33,162,807 M46K possibly damaging Het
Wdr90 G A 17: 25,851,455 P1104L probably damaging Het
Znhit6 T C 3: 145,594,658 S230P probably damaging Het
Other mutations in Spon1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01359:Spon1 APN 7 114034290 missense probably damaging 1.00
IGL02385:Spon1 APN 7 113766330 start codon destroyed probably null 0.56
IGL02496:Spon1 APN 7 114036662 missense probably benign 0.00
IGL02562:Spon1 APN 7 114036761 missense probably benign 0.12
IGL03063:Spon1 APN 7 114033025 missense possibly damaging 0.85
IGL03153:Spon1 APN 7 114030344 missense probably damaging 1.00
IGL03392:Spon1 APN 7 114034287 missense probably damaging 0.99
Rust UTSW 7 114016791 missense possibly damaging 0.77
Wilt UTSW 7 113766384 missense probably damaging 0.98
R0512:Spon1 UTSW 7 113836833 missense possibly damaging 0.59
R0646:Spon1 UTSW 7 114039821 missense probably benign 0.04
R1194:Spon1 UTSW 7 113886798 missense probably benign
R1832:Spon1 UTSW 7 114016785 missense probably benign 0.26
R3747:Spon1 UTSW 7 113766384 missense probably damaging 0.98
R3747:Spon1 UTSW 7 114016791 missense possibly damaging 0.77
R3749:Spon1 UTSW 7 113766384 missense probably damaging 0.98
R3749:Spon1 UTSW 7 114016791 missense possibly damaging 0.77
R3750:Spon1 UTSW 7 113766384 missense probably damaging 0.98
R3750:Spon1 UTSW 7 114016791 missense possibly damaging 0.77
R4666:Spon1 UTSW 7 114028969 missense probably benign 0.20
R4730:Spon1 UTSW 7 114033071 missense possibly damaging 0.92
R4774:Spon1 UTSW 7 114039867 missense probably damaging 0.99
R5855:Spon1 UTSW 7 114029072 missense probably damaging 0.99
R5870:Spon1 UTSW 7 114031786 missense probably damaging 1.00
R5914:Spon1 UTSW 7 114030821 missense probably damaging 1.00
R6523:Spon1 UTSW 7 113886785 missense probably benign 0.00
R7138:Spon1 UTSW 7 114036710 missense probably damaging 1.00
R7295:Spon1 UTSW 7 114030240 missense possibly damaging 0.85
R7844:Spon1 UTSW 7 114030332 missense probably benign 0.01
R8064:Spon1 UTSW 7 114036621 missense probably damaging 1.00
R8075:Spon1 UTSW 7 114016793 critical splice donor site probably null
R8927:Spon1 UTSW 7 114030357 critical splice donor site probably null
R8928:Spon1 UTSW 7 114030357 critical splice donor site probably null
R9278:Spon1 UTSW 7 114028953 missense probably damaging 1.00
Z1088:Spon1 UTSW 7 113766386 missense possibly damaging 0.83
Z1176:Spon1 UTSW 7 113927794 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GAGCCTTACAAATCAATGCAACTG -3'
(R):5'- ATGAAACTGTCAGAACAATGCC -3'

Sequencing Primer
(F):5'- CTGTATTGCATCTTCTTTATACAGGG -3'
(R):5'- TGTCAGAACAATGCCATTCAAAG -3'
Posted On 2014-11-11