Incidental Mutation 'R2391:1110004F10Rik'
ID 247764
Institutional Source Beutler Lab
Gene Symbol 1110004F10Rik
Ensembl Gene ENSMUSG00000030663
Gene Name RIKEN cDNA 1110004F10 gene
Synonyms sid2057
MMRRC Submission 040359-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.228) question?
Stock # R2391 (G1)
Quality Score 225
Status Validated
Chromosome 7
Chromosomal Location 116039397-116105210 bp(+) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) T to A at 116104226 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Aspartic acid to Glutamic Acid at position 24 (D24E)
Ref Sequence ENSEMBL: ENSMUSP00000102218 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000032899] [ENSMUST00000106607] [ENSMUST00000106608] [ENSMUST00000151254] [ENSMUST00000205427] [ENSMUST00000205450]
AlphaFold Q9R0P4
Predicted Effect probably benign
Transcript: ENSMUST00000032899
AA Change: D111E

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000032899
Gene: ENSMUSG00000030663
AA Change: D111E

DomainStartEndE-ValueType
Pfam:SMAP 27 103 1.1e-17 PFAM
low complexity region 105 155 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000106607
AA Change: D24E

PolyPhen 2 Score 0.993 (Sensitivity: 0.70; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000102218
Gene: ENSMUSG00000030663
AA Change: D24E

DomainStartEndE-ValueType
low complexity region 18 68 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000106608
AA Change: D67E

PolyPhen 2 Score 0.805 (Sensitivity: 0.84; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000102219
Gene: ENSMUSG00000030663
AA Change: D67E

DomainStartEndE-ValueType
Pfam:SMAP 1 59 7.8e-10 PFAM
low complexity region 61 111 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000151254
SMART Domains Protein: ENSMUSP00000116035
Gene: ENSMUSG00000030663

DomainStartEndE-ValueType
Pfam:SMAP 26 79 4.4e-13 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000205427
Predicted Effect probably benign
Transcript: ENSMUST00000205450
Meta Mutation Damage Score 0.0723 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.5%
  • 10x: 97.0%
  • 20x: 94.2%
Validation Efficiency 100% (36/36)
Allele List at MGI
Other mutations in this stock
Total: 32 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca4 A G 3: 122,158,422 H689R probably benign Het
Acss3 T G 10: 107,123,487 T33P probably benign Het
BC005537 T A 13: 24,809,915 Y124* probably null Het
Capn2 T C 1: 182,478,609 D524G probably benign Het
Catsperb A G 12: 101,624,706 Y1011C probably damaging Het
Cdk18 G T 1: 132,115,474 Q438K probably benign Het
Ckap5 A G 2: 91,585,869 M1047V possibly damaging Het
Dab1 C T 4: 104,731,751 A524V probably benign Het
Dmbt1 T A 7: 131,106,468 I1306N probably damaging Het
Emp2 A T 16: 10,284,588 I120N probably damaging Het
Gm2888 A T 14: 3,037,656 D216V possibly damaging Het
Naa16 T A 14: 79,370,049 H287L probably benign Het
Odf3l2 A T 10: 79,645,650 V15E probably benign Het
Olfm5 A G 7: 104,160,834 S107P probably benign Het
Olfr1419 G T 19: 11,870,816 Y133* probably null Het
Olfr421-ps1 T C 1: 174,152,098 V194A probably benign Het
Olfr78 C A 7: 102,742,374 V210F possibly damaging Het
Ptpn2 A T 18: 67,675,889 probably null Het
Serpinb8 A G 1: 107,607,069 D290G probably damaging Het
Sfmbt2 T C 2: 10,445,693 Y260H possibly damaging Het
Slc6a20a A T 9: 123,664,621 V65E probably damaging Het
Spon1 C T 7: 113,886,847 T210M probably damaging Het
Sugp1 T C 8: 70,059,411 probably null Het
Tas2r143 C A 6: 42,400,876 H213Q probably damaging Het
Terf1 C A 1: 15,805,739 S21* probably null Het
Trim12a T C 7: 104,306,931 E134G probably damaging Het
Trip12 TATACATACATACATACATACATACATACATAC TATACATACATACATACATACATACATACATACATAC 1: 84,814,790 probably null Het
Tssk5 T C 15: 76,374,551 Y45C probably benign Het
Usp29 T A 7: 6,963,771 probably null Het
Wdfy4 A T 14: 33,162,807 M46K possibly damaging Het
Wdr90 G A 17: 25,851,455 P1104L probably damaging Het
Znhit6 T C 3: 145,594,658 S230P probably damaging Het
Other mutations in 1110004F10Rik
AlleleSourceChrCoordTypePredicted EffectPPH Score
R4789:1110004F10Rik UTSW 7 116093522 missense probably benign 0.03
R6249:1110004F10Rik UTSW 7 116103270 missense probably damaging 1.00
R6802:1110004F10Rik UTSW 7 116099490 missense probably damaging 1.00
R7960:1110004F10Rik UTSW 7 116103246 missense possibly damaging 0.83
R8509:1110004F10Rik UTSW 7 116104434 missense possibly damaging 0.83
R9063:1110004F10Rik UTSW 7 116104425 missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- ACCTAATACTATGAAGTGGACGG -3'
(R):5'- GAGCCACTGGACTTGACAAAC -3'

Sequencing Primer
(F):5'- TGTAAACCCTGCTGGAACTTG -3'
(R):5'- GCCACTGGACTTGACAAACATCATC -3'
Posted On 2014-11-11