Incidental Mutation 'R0299:Olfr1338'
ID24778
Institutional Source Beutler Lab
Gene Symbol Olfr1338
Ensembl Gene ENSMUSG00000095218
Gene Nameolfactory receptor 1338
SynonymsMOR259-9, GA_x6K02T2QD9B-18795136-18796077, MOR259-4P, MOR259-4P, Olfr1524-ps1
MMRRC Submission 038513-MU
Accession Numbers
Is this an essential gene? Possibly essential (E-score: 0.531) question?
Stock #R0299 (G1)
Quality Score225
Status Validated
Chromosome4
Chromosomal Location118751975-118758737 bp(-) (GRCm38)
Type of Mutationstart codon destroyed
DNA Base Change (assembly) A to T at 118754535 bp
ZygosityHeterozygous
Amino Acid Change Methionine to Lysine at position 1 (M1K)
Ref Sequence ENSEMBL: ENSMUSP00000092427 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000084315] [ENSMUST00000214922] [ENSMUST00000216559]
Predicted Effect probably null
Transcript: ENSMUST00000084315
AA Change: M1K

PolyPhen 2 Score 0.820 (Sensitivity: 0.84; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000092427
Gene: ENSMUSG00000095218
AA Change: M1K

DomainStartEndE-ValueType
Pfam:7tm_4 32 308 3.3e-55 PFAM
Pfam:7TM_GPCR_Srsx 36 306 1e-8 PFAM
Pfam:7tm_1 42 291 1.8e-26 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000214922
AA Change: M3K

PolyPhen 2 Score 0.088 (Sensitivity: 0.93; Specificity: 0.85)
Predicted Effect probably benign
Transcript: ENSMUST00000216559
AA Change: M3K

PolyPhen 2 Score 0.088 (Sensitivity: 0.93; Specificity: 0.85)
Meta Mutation Damage Score 0.9755 question?
Coding Region Coverage
  • 1x: 98.8%
  • 3x: 97.8%
  • 10x: 95.3%
  • 20x: 90.1%
Validation Efficiency 100% (61/61)
MGI Phenotype FUNCTION: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 62 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930503L19Rik G A 18: 70,469,482 Q87* probably null Het
4933427I04Rik A T 4: 123,860,822 R176S possibly damaging Het
A2ml1 T G 6: 128,553,232 probably benign Het
Abca13 G A 11: 9,298,076 E2608K probably benign Het
Acpp T C 9: 104,320,002 E146G probably damaging Het
Adcy8 T A 15: 64,716,166 D894V probably damaging Het
Ap4b1 T C 3: 103,809,946 M1T probably null Het
Arg2 A G 12: 79,147,612 D70G probably damaging Het
Atxn1 A G 13: 45,567,169 S417P probably damaging Het
Btbd10 A T 7: 113,329,878 S230T possibly damaging Het
Carmil1 T A 13: 24,082,020 N253I probably damaging Het
Celf6 C A 9: 59,602,878 T86K probably benign Het
Clec2h T C 6: 128,670,895 V69A probably damaging Het
Col15a1 A T 4: 47,262,950 D534V probably damaging Het
Col16a1 TCCCC TCCC 4: 130,058,318 probably null Het
Degs1 A T 1: 182,279,271 I141N probably damaging Het
Dnah1 C T 14: 31,276,158 G2574D probably damaging Het
Dnah8 T A 17: 30,715,509 F1489L possibly damaging Het
Dock10 T C 1: 80,536,929 R1424G probably damaging Het
Elp2 T C 18: 24,634,409 I716T probably benign Het
Frk T C 10: 34,484,371 probably null Het
Fshr C G 17: 89,009,285 S169T probably benign Het
Gin1 T A 1: 97,783,016 S141R possibly damaging Het
Gm11596 G A 11: 99,792,944 P117S unknown Het
Gm6327 T C 16: 12,761,197 noncoding transcript Het
Hepacam2 A G 6: 3,476,121 L268P probably damaging Het
Hps6 G A 19: 46,004,232 V203M probably damaging Het
Hsd17b7 G A 1: 169,959,794 probably benign Het
Il18rap A T 1: 40,525,058 H112L probably benign Het
Il1r2 T A 1: 40,123,149 Y317* probably null Het
Ints8 C A 4: 11,246,097 V190L probably benign Het
Me2 A G 18: 73,770,673 S575P probably benign Het
Mecom A G 3: 29,980,411 L372P probably benign Het
Mss51 T A 14: 20,484,688 Q338L possibly damaging Het
Muc2 C T 7: 141,752,729 T296I probably damaging Het
Muc4 A T 16: 32,750,195 probably benign Het
Neto1 G A 18: 86,461,320 R211Q probably benign Het
Nisch A G 14: 31,171,924 Y1231H probably damaging Het
Olfr1331 A G 4: 118,869,416 I212V probably benign Het
Pcsk6 T C 7: 66,039,043 V820A probably benign Het
Pdcd10 T C 3: 75,527,651 K111R probably damaging Het
Pdgfrb T A 18: 61,068,852 V496E probably benign Het
Pelo A T 13: 115,088,903 C40* probably null Het
Plxnc1 C T 10: 94,849,821 probably null Het
Ptpru G A 4: 131,803,387 Q519* probably null Het
Pzp A G 6: 128,495,330 probably benign Het
Rad21 A T 15: 51,965,030 D547E probably benign Het
Serpina1d A T 12: 103,765,757 L281Q probably damaging Het
Serpina9 T C 12: 104,001,470 N222S probably benign Het
Sh3bgrl2 A G 9: 83,577,559 K57E probably damaging Het
Shtn1 T C 19: 59,018,951 E289G probably benign Het
Sik3 T C 9: 46,208,740 M659T possibly damaging Het
Slamf7 G A 1: 171,648,931 probably benign Het
Sppl3 T A 5: 115,088,994 probably benign Het
Suco G A 1: 161,853,810 T253I probably benign Het
Tecta T C 9: 42,352,063 D1409G probably damaging Het
Tram2 T C 1: 21,004,244 D238G probably damaging Het
Trpm3 T C 19: 22,986,873 M1244T possibly damaging Het
Trub1 A G 19: 57,483,625 T178A possibly damaging Het
Ugcg G C 4: 59,217,036 V187L possibly damaging Het
Vmn1r25 T A 6: 57,978,509 Q265L probably damaging Het
Zfp821 G T 8: 109,724,230 R285L probably damaging Het
Other mutations in Olfr1338
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01092:Olfr1338 APN 4 118753762 missense possibly damaging 0.78
IGL02726:Olfr1338 APN 4 118753764 missense probably benign 0.00
IGL02928:Olfr1338 APN 4 118754500 missense probably damaging 1.00
IGL03102:Olfr1338 APN 4 118753934 missense probably benign 0.00
R0062:Olfr1338 UTSW 4 118753903 missense probably benign 0.00
R0062:Olfr1338 UTSW 4 118753903 missense probably benign 0.00
R0501:Olfr1338 UTSW 4 118753830 missense probably benign 0.00
R1301:Olfr1338 UTSW 4 118753619 missense probably benign
R1719:Olfr1338 UTSW 4 118753600 missense possibly damaging 0.78
R2327:Olfr1338 UTSW 4 118754134 missense probably benign 0.13
R3110:Olfr1338 UTSW 4 118754224 missense probably damaging 0.99
R3112:Olfr1338 UTSW 4 118754224 missense probably damaging 0.99
R4582:Olfr1338 UTSW 4 118753893 missense probably damaging 1.00
R4615:Olfr1338 UTSW 4 118754137 missense probably benign 0.34
R5640:Olfr1338 UTSW 4 118753789 missense probably benign 0.07
R6513:Olfr1338 UTSW 4 118754027 nonsense probably null
R6889:Olfr1338 UTSW 4 118754307 missense probably damaging 0.99
R7157:Olfr1338 UTSW 4 118754418 missense possibly damaging 0.93
R7168:Olfr1338 UTSW 4 118753851 missense probably damaging 0.98
R7378:Olfr1338 UTSW 4 118754175 missense possibly damaging 0.74
R7451:Olfr1338 UTSW 4 118753687 missense probably benign 0.03
R7770:Olfr1338 UTSW 4 118754057 missense probably benign 0.04
R7847:Olfr1338 UTSW 4 118754368 missense possibly damaging 0.79
Predicted Primers PCR Primer
(F):5'- GCAGACCAGCATGATGATGAGTCC -3'
(R):5'- GATCTGACCACTGAACTCAGAAGCC -3'

Sequencing Primer
(F):5'- ATGATGAGTCCGTTGCCCAG -3'
(R):5'- gtgtagcctgtggaggtg -3'
Posted On2013-04-16