Incidental Mutation 'R2392:Psd4'
ID247786
Institutional Source Beutler Lab
Gene Symbol Psd4
Ensembl Gene ENSMUSG00000026979
Gene Namepleckstrin and Sec7 domain containing 4
SynonymsSEC7 homolog, EFA6B
MMRRC Submission 040360-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R2392 (G1)
Quality Score225
Status Validated
Chromosome2
Chromosomal Location24367580-24414954 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to A at 24394667 bp
ZygosityHeterozygous
Amino Acid Change Proline to Glutamine at position 181 (P181Q)
Ref Sequence ENSEMBL: ENSMUSP00000132395 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000056641] [ENSMUST00000102942] [ENSMUST00000127242] [ENSMUST00000131930] [ENSMUST00000140547] [ENSMUST00000142522] [ENSMUST00000166388]
Predicted Effect probably damaging
Transcript: ENSMUST00000056641
AA Change: P181Q

PolyPhen 2 Score 0.980 (Sensitivity: 0.75; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000062415
Gene: ENSMUSG00000026979
AA Change: P181Q

DomainStartEndE-ValueType
low complexity region 156 176 N/A INTRINSIC
low complexity region 350 361 N/A INTRINSIC
low complexity region 420 438 N/A INTRINSIC
low complexity region 458 474 N/A INTRINSIC
Sec7 497 688 9.39e-47 SMART
PH 727 843 1.1e-10 SMART
low complexity region 883 893 N/A INTRINSIC
low complexity region 897 920 N/A INTRINSIC
low complexity region 961 973 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000102942
AA Change: P181Q

PolyPhen 2 Score 0.980 (Sensitivity: 0.75; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000100006
Gene: ENSMUSG00000026979
AA Change: P181Q

DomainStartEndE-ValueType
low complexity region 156 176 N/A INTRINSIC
low complexity region 350 361 N/A INTRINSIC
low complexity region 420 438 N/A INTRINSIC
low complexity region 458 474 N/A INTRINSIC
Sec7 497 688 9.39e-47 SMART
PH 727 843 1.1e-10 SMART
low complexity region 883 893 N/A INTRINSIC
low complexity region 897 920 N/A INTRINSIC
low complexity region 961 973 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000127242
Predicted Effect probably benign
Transcript: ENSMUST00000131930
Predicted Effect noncoding transcript
Transcript: ENSMUST00000133730
Predicted Effect probably benign
Transcript: ENSMUST00000140547
Predicted Effect probably benign
Transcript: ENSMUST00000142522
Predicted Effect probably damaging
Transcript: ENSMUST00000166388
AA Change: P181Q

PolyPhen 2 Score 0.980 (Sensitivity: 0.75; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000132395
Gene: ENSMUSG00000026979
AA Change: P181Q

DomainStartEndE-ValueType
low complexity region 156 176 N/A INTRINSIC
low complexity region 350 361 N/A INTRINSIC
low complexity region 420 438 N/A INTRINSIC
low complexity region 458 474 N/A INTRINSIC
Sec7 497 688 9.39e-47 SMART
PH 727 843 1.1e-10 SMART
low complexity region 883 893 N/A INTRINSIC
low complexity region 897 920 N/A INTRINSIC
low complexity region 961 973 N/A INTRINSIC
Meta Mutation Damage Score 0.6467 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.5%
  • 10x: 97.0%
  • 20x: 94.1%
Validation Efficiency 96% (53/55)
Allele List at MGI
Other mutations in this stock
Total: 53 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca12 A T 1: 71,258,105 S2409T probably damaging Het
Acap2 A G 16: 31,139,640 F120S probably damaging Het
Akr1c6 A G 13: 4,434,478 probably null Het
Bptf C A 11: 107,072,747 A1874S probably damaging Het
Ccnl1 A G 3: 65,948,752 V244A probably damaging Het
Cenpe T G 3: 135,248,113 L1628R probably damaging Het
Cfap54 A G 10: 93,025,011 probably null Het
Chchd7 T A 4: 3,943,381 probably null Het
Col9a2 C G 4: 121,054,258 R599G probably damaging Het
Crybg2 G T 4: 134,072,614 V362L probably benign Het
Ddx11 T A 17: 66,149,973 V791E probably damaging Het
Disp1 G A 1: 183,087,167 P1230S probably benign Het
Elp5 T C 11: 69,975,102 H116R probably benign Het
Epb42 T C 2: 121,029,987 E177G possibly damaging Het
F13a1 T A 13: 36,943,997 I336F possibly damaging Het
Fabp3 C T 4: 130,312,387 T57I probably benign Het
Fuk A G 8: 110,889,724 M453T probably benign Het
Hacd2 A T 16: 35,106,378 E249V probably benign Het
Hnrnpf C A 6: 117,924,868 A371D possibly damaging Het
Jmjd1c A G 10: 67,229,904 T1703A probably damaging Het
Kcnj13 G A 1: 87,386,900 T200I possibly damaging Het
Kif1b G A 4: 149,220,620 T949M possibly damaging Het
Klhl35 G A 7: 99,473,824 A552T possibly damaging Het
Krt74 A G 15: 101,756,801 noncoding transcript Het
Krtap14 T A 16: 88,825,709 probably null Het
Lrrc45 A G 11: 120,719,539 N492S probably benign Het
Lrrcc1 T A 3: 14,536,520 N114K probably damaging Het
Mfsd2b T C 12: 4,865,164 D375G possibly damaging Het
Mgat4a A G 1: 37,498,704 L44P probably damaging Het
Mttp A C 3: 138,095,021 D774E probably damaging Het
Myo5a T C 9: 75,209,239 V1554A probably benign Het
Nes C T 3: 87,975,943 A503V probably benign Het
Nme8 A G 13: 19,688,943 probably null Het
Nr4a1 A G 15: 101,274,194 D583G possibly damaging Het
Olfr109 A G 17: 37,466,419 Y71C probably damaging Het
Olfr177 A G 16: 58,872,434 S239P probably damaging Het
Pnpla8 T A 12: 44,311,504 L746I probably damaging Het
Ppp1r7 A T 1: 93,354,341 I205F probably benign Het
Ripor2 G A 13: 24,706,223 V694I probably benign Het
Scn10a A G 9: 119,627,202 S1185P possibly damaging Het
Sec23b T A 2: 144,585,587 probably null Het
Slfn2 A G 11: 83,065,328 N12S possibly damaging Het
Slfn4 A G 11: 83,185,422 K38R possibly damaging Het
Smarca2 G T 19: 26,640,650 probably null Het
Taar4 A G 10: 23,961,274 T261A possibly damaging Het
Tbl2 A G 5: 135,156,514 D159G probably benign Het
Tmem120a T C 5: 135,742,038 E55G probably damaging Het
Ttc21b A G 2: 66,207,450 probably null Het
Vill A T 9: 119,067,560 probably benign Het
Vmn2r28 A T 7: 5,484,131 M511K probably damaging Het
Vmn2r81 A T 10: 79,274,682 D543V probably damaging Het
Wdr95 A G 5: 149,580,670 T314A probably benign Het
Zbtb8b A G 4: 129,433,189 I61T probably damaging Het
Other mutations in Psd4
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00850:Psd4 APN 2 24394286 missense probably benign 0.25
IGL01302:Psd4 APN 2 24396787 critical splice donor site probably null
IGL01446:Psd4 APN 2 24405395 missense probably damaging 1.00
IGL01577:Psd4 APN 2 24403222 missense probably damaging 0.96
IGL01823:Psd4 APN 2 24394432 missense probably benign 0.27
IGL02103:Psd4 APN 2 24400528 nonsense probably null
IGL02212:Psd4 APN 2 24405314 nonsense probably null
IGL02240:Psd4 APN 2 24396377 missense probably benign 0.00
IGL02261:Psd4 APN 2 24401744 missense probably damaging 1.00
IGL02345:Psd4 APN 2 24401823 critical splice donor site probably null
IGL03272:Psd4 APN 2 24405680 splice site probably benign
bitcoin UTSW 2 24401557 missense probably damaging 1.00
crypto UTSW 2 24397247 missense probably benign
underworld UTSW 2 24405351 missense probably damaging 1.00
PIT4469001:Psd4 UTSW 2 24394294 missense probably benign 0.08
R0131:Psd4 UTSW 2 24405351 missense probably damaging 1.00
R0131:Psd4 UTSW 2 24405351 missense probably damaging 1.00
R0132:Psd4 UTSW 2 24405351 missense probably damaging 1.00
R0278:Psd4 UTSW 2 24394438 missense probably damaging 1.00
R1303:Psd4 UTSW 2 24395018 missense probably benign 0.00
R1551:Psd4 UTSW 2 24403280 missense probably benign 0.02
R1715:Psd4 UTSW 2 24405332 missense probably damaging 1.00
R1854:Psd4 UTSW 2 24397456 missense probably benign 0.26
R1942:Psd4 UTSW 2 24405793 missense probably damaging 1.00
R2420:Psd4 UTSW 2 24401241 missense probably damaging 1.00
R4509:Psd4 UTSW 2 24396335 missense probably benign
R4512:Psd4 UTSW 2 24402889 missense probably damaging 1.00
R4558:Psd4 UTSW 2 24404794 missense probably damaging 1.00
R4995:Psd4 UTSW 2 24397247 missense probably benign
R5120:Psd4 UTSW 2 24405438 missense probably benign
R5314:Psd4 UTSW 2 24400516 missense possibly damaging 0.89
R5563:Psd4 UTSW 2 24394885 missense probably benign
R5638:Psd4 UTSW 2 24397415 missense probably benign 0.14
R6191:Psd4 UTSW 2 24394487 missense probably damaging 1.00
R6224:Psd4 UTSW 2 24401557 missense probably damaging 1.00
R7024:Psd4 UTSW 2 24394543 missense possibly damaging 0.76
R7046:Psd4 UTSW 2 24394973 missense probably benign 0.05
R7209:Psd4 UTSW 2 24397345 missense probably damaging 1.00
R7483:Psd4 UTSW 2 24404756 missense possibly damaging 0.65
R7498:Psd4 UTSW 2 24406984 missense probably damaging 1.00
R7571:Psd4 UTSW 2 24407011 missense probably damaging 1.00
X0009:Psd4 UTSW 2 24401525 missense probably damaging 1.00
X0064:Psd4 UTSW 2 24404738 missense probably damaging 0.99
Predicted Primers PCR Primer
(F):5'- TGGGGAGTCCACAGCAAAAC -3'
(R):5'- TGATGCCAGGTCTTCATGTC -3'

Sequencing Primer
(F):5'- CAGATGTGTGTCCTGGACC -3'
(R):5'- CCAGGTCTTCATGTCTGGGTG -3'
Posted On2014-11-11