Incidental Mutation 'R2392:Sec23b'
ID247789
Institutional Source Beutler Lab
Gene Symbol Sec23b
Ensembl Gene ENSMUSG00000027429
Gene NameSEC23 homolog B, COPII coat complex component
Synonyms
MMRRC Submission 040360-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R2392 (G1)
Quality Score192
Status Validated
Chromosome2
Chromosomal Location144556229-144590749 bp(+) (GRCm38)
Type of Mutationsplice site
DNA Base Change (assembly) T to A at 144585587 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000028916 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000028916] [ENSMUST00000028916] [ENSMUST00000028916] [ENSMUST00000028916]
Predicted Effect probably null
Transcript: ENSMUST00000028916
SMART Domains Protein: ENSMUSP00000028916
Gene: ENSMUSG00000027429

DomainStartEndE-ValueType
Pfam:zf-Sec23_Sec24 58 98 4.3e-17 PFAM
Pfam:Sec23_trunk 126 392 2.3e-82 PFAM
Pfam:Sec23_BS 403 506 7.2e-33 PFAM
Pfam:Sec23_helical 522 620 1.1e-28 PFAM
Pfam:Gelsolin 631 720 1e-18 PFAM
Predicted Effect probably null
Transcript: ENSMUST00000028916
SMART Domains Protein: ENSMUSP00000028916
Gene: ENSMUSG00000027429

DomainStartEndE-ValueType
Pfam:zf-Sec23_Sec24 58 98 4.3e-17 PFAM
Pfam:Sec23_trunk 126 392 2.3e-82 PFAM
Pfam:Sec23_BS 403 506 7.2e-33 PFAM
Pfam:Sec23_helical 522 620 1.1e-28 PFAM
Pfam:Gelsolin 631 720 1e-18 PFAM
Predicted Effect probably null
Transcript: ENSMUST00000028916
SMART Domains Protein: ENSMUSP00000028916
Gene: ENSMUSG00000027429

DomainStartEndE-ValueType
Pfam:zf-Sec23_Sec24 58 98 4.3e-17 PFAM
Pfam:Sec23_trunk 126 392 2.3e-82 PFAM
Pfam:Sec23_BS 403 506 7.2e-33 PFAM
Pfam:Sec23_helical 522 620 1.1e-28 PFAM
Pfam:Gelsolin 631 720 1e-18 PFAM
Predicted Effect probably null
Transcript: ENSMUST00000028916
SMART Domains Protein: ENSMUSP00000028916
Gene: ENSMUSG00000027429

DomainStartEndE-ValueType
Pfam:zf-Sec23_Sec24 58 98 4.3e-17 PFAM
Pfam:Sec23_trunk 126 392 2.3e-82 PFAM
Pfam:Sec23_BS 403 506 7.2e-33 PFAM
Pfam:Sec23_helical 522 620 1.1e-28 PFAM
Pfam:Gelsolin 631 720 1e-18 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000128210
Predicted Effect noncoding transcript
Transcript: ENSMUST00000146487
Meta Mutation Damage Score 0.9755 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.5%
  • 10x: 97.0%
  • 20x: 94.1%
Validation Efficiency 96% (53/55)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a member of the SEC23 subfamily of the SEC23/SEC24 family, which is involved in vesicle trafficking. The encoded protein has similarity to yeast Sec23p component of COPII. COPII is the coat protein complex responsible for vesicle budding from the ER. The function of this gene product has been implicated in cargo selection and concentration. Multiple alternatively spliced transcript variants have been identified in this gene. [provided by RefSeq, Feb 2010]
PHENOTYPE: Mice homozygous for a null mutation display complete neonatal lethality, fail to suckle, and show degeneration of the secretory tissues in the pancreas, salivary gland, and gastric glands. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 53 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca12 A T 1: 71,258,105 S2409T probably damaging Het
Acap2 A G 16: 31,139,640 F120S probably damaging Het
Akr1c6 A G 13: 4,434,478 probably null Het
Bptf C A 11: 107,072,747 A1874S probably damaging Het
Ccnl1 A G 3: 65,948,752 V244A probably damaging Het
Cenpe T G 3: 135,248,113 L1628R probably damaging Het
Cfap54 A G 10: 93,025,011 probably null Het
Chchd7 T A 4: 3,943,381 probably null Het
Col9a2 C G 4: 121,054,258 R599G probably damaging Het
Crybg2 G T 4: 134,072,614 V362L probably benign Het
Ddx11 T A 17: 66,149,973 V791E probably damaging Het
Disp1 G A 1: 183,087,167 P1230S probably benign Het
Elp5 T C 11: 69,975,102 H116R probably benign Het
Epb42 T C 2: 121,029,987 E177G possibly damaging Het
F13a1 T A 13: 36,943,997 I336F possibly damaging Het
Fabp3 C T 4: 130,312,387 T57I probably benign Het
Fuk A G 8: 110,889,724 M453T probably benign Het
Hacd2 A T 16: 35,106,378 E249V probably benign Het
Hnrnpf C A 6: 117,924,868 A371D possibly damaging Het
Jmjd1c A G 10: 67,229,904 T1703A probably damaging Het
Kcnj13 G A 1: 87,386,900 T200I possibly damaging Het
Kif1b G A 4: 149,220,620 T949M possibly damaging Het
Klhl35 G A 7: 99,473,824 A552T possibly damaging Het
Krt74 A G 15: 101,756,801 noncoding transcript Het
Krtap14 T A 16: 88,825,709 probably null Het
Lrrc45 A G 11: 120,719,539 N492S probably benign Het
Lrrcc1 T A 3: 14,536,520 N114K probably damaging Het
Mfsd2b T C 12: 4,865,164 D375G possibly damaging Het
Mgat4a A G 1: 37,498,704 L44P probably damaging Het
Mttp A C 3: 138,095,021 D774E probably damaging Het
Myo5a T C 9: 75,209,239 V1554A probably benign Het
Nes C T 3: 87,975,943 A503V probably benign Het
Nme8 A G 13: 19,688,943 probably null Het
Nr4a1 A G 15: 101,274,194 D583G possibly damaging Het
Olfr109 A G 17: 37,466,419 Y71C probably damaging Het
Olfr177 A G 16: 58,872,434 S239P probably damaging Het
Pnpla8 T A 12: 44,311,504 L746I probably damaging Het
Ppp1r7 A T 1: 93,354,341 I205F probably benign Het
Psd4 C A 2: 24,394,667 P181Q probably damaging Het
Ripor2 G A 13: 24,706,223 V694I probably benign Het
Scn10a A G 9: 119,627,202 S1185P possibly damaging Het
Slfn2 A G 11: 83,065,328 N12S possibly damaging Het
Slfn4 A G 11: 83,185,422 K38R possibly damaging Het
Smarca2 G T 19: 26,640,650 probably null Het
Taar4 A G 10: 23,961,274 T261A possibly damaging Het
Tbl2 A G 5: 135,156,514 D159G probably benign Het
Tmem120a T C 5: 135,742,038 E55G probably damaging Het
Ttc21b A G 2: 66,207,450 probably null Het
Vill A T 9: 119,067,560 probably benign Het
Vmn2r28 A T 7: 5,484,131 M511K probably damaging Het
Vmn2r81 A T 10: 79,274,682 D543V probably damaging Het
Wdr95 A G 5: 149,580,670 T314A probably benign Het
Zbtb8b A G 4: 129,433,189 I61T probably damaging Het
Other mutations in Sec23b
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00659:Sec23b APN 2 144583770 critical splice donor site probably null
IGL00668:Sec23b APN 2 144559218 utr 5 prime probably benign
IGL00714:Sec23b APN 2 144559225 missense probably benign 0.33
IGL00914:Sec23b APN 2 144566864 missense probably damaging 1.00
IGL01084:Sec23b APN 2 144564589 missense possibly damaging 0.81
IGL01341:Sec23b APN 2 144585733 missense probably benign 0.00
IGL01377:Sec23b APN 2 144559237 missense probably damaging 0.97
IGL01634:Sec23b APN 2 144559230 missense probably damaging 0.96
IGL02321:Sec23b APN 2 144579405 critical splice donor site probably null
IGL03027:Sec23b APN 2 144587545 missense possibly damaging 0.55
IGL03064:Sec23b APN 2 144582032 missense probably benign 0.00
IGL03105:Sec23b APN 2 144582020 missense probably damaging 1.00
IGL03240:Sec23b APN 2 144566759 splice site probably benign
R0004:Sec23b UTSW 2 144564562 splice site probably benign
R0092:Sec23b UTSW 2 144566910 missense probably benign 0.21
R0409:Sec23b UTSW 2 144567912 missense probably benign 0.22
R0426:Sec23b UTSW 2 144568612 unclassified probably benign
R0441:Sec23b UTSW 2 144581997 missense probably damaging 1.00
R1034:Sec23b UTSW 2 144590338 missense possibly damaging 0.87
R1624:Sec23b UTSW 2 144567129 missense probably benign
R2020:Sec23b UTSW 2 144566944 missense possibly damaging 0.49
R3946:Sec23b UTSW 2 144581973 missense probably benign
R4407:Sec23b UTSW 2 144574718 missense possibly damaging 0.53
R4448:Sec23b UTSW 2 144559251 missense probably benign 0.43
R4519:Sec23b UTSW 2 144582015 missense possibly damaging 0.86
R4522:Sec23b UTSW 2 144578366 missense possibly damaging 0.80
R4654:Sec23b UTSW 2 144572574 missense probably benign 0.33
R4849:Sec23b UTSW 2 144585599 missense probably damaging 0.96
R4876:Sec23b UTSW 2 144586361 splice site probably null
R4983:Sec23b UTSW 2 144581953 missense probably benign 0.06
R6169:Sec23b UTSW 2 144586974 missense probably damaging 1.00
R6702:Sec23b UTSW 2 144559189 intron probably null
R6703:Sec23b UTSW 2 144559189 intron probably null
R6748:Sec23b UTSW 2 144566794 missense probably damaging 1.00
R7238:Sec23b UTSW 2 144590338 missense possibly damaging 0.87
R7511:Sec23b UTSW 2 144590349 missense probably benign 0.30
R7845:Sec23b UTSW 2 144559396 missense possibly damaging 0.67
R8177:Sec23b UTSW 2 144585623 missense probably benign 0.03
R8183:Sec23b UTSW 2 144559269 missense probably benign 0.08
R8238:Sec23b UTSW 2 144564648 missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- GTGTGTCCAGTAGAAGGCACTC -3'
(R):5'- ATGGCATTCTGAGGAAAGCGC -3'

Sequencing Primer
(F):5'- AGTAGAAGGCACTCTCTATTTCC -3'
(R):5'- AAAGCGCGTATGTCCGTTC -3'
Posted On2014-11-11