Incidental Mutation 'R2392:Lrrcc1'
ID247790
Institutional Source Beutler Lab
Gene Symbol Lrrcc1
Ensembl Gene ENSMUSG00000027550
Gene Nameleucine rich repeat and coiled-coil domain containing 1
Synonyms
MMRRC Submission 040360-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R2392 (G1)
Quality Score225
Status Validated
Chromosome3
Chromosomal Location14533788-14572658 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 14536520 bp
ZygosityHeterozygous
Amino Acid Change Asparagine to Lysine at position 114 (N114K)
Ref Sequence ENSEMBL: ENSMUSP00000126560 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000091325] [ENSMUST00000108370] [ENSMUST00000163660] [ENSMUST00000165436] [ENSMUST00000169079]
Predicted Effect probably damaging
Transcript: ENSMUST00000091325
AA Change: N114K

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000088875
Gene: ENSMUSG00000027550
AA Change: N114K

DomainStartEndE-ValueType
Pfam:LRR_8 60 116 1.1e-9 PFAM
Pfam:LRR_4 82 126 4.8e-8 PFAM
Blast:LRR 130 151 1e-5 BLAST
coiled coil region 412 626 N/A INTRINSIC
coiled coil region 675 718 N/A INTRINSIC
coiled coil region 757 1010 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000108370
AA Change: N114K

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000104007
Gene: ENSMUSG00000027550
AA Change: N114K

DomainStartEndE-ValueType
Pfam:LRR_8 60 116 1.1e-9 PFAM
Pfam:LRR_4 82 124 4.5e-8 PFAM
Blast:LRR 130 151 1e-5 BLAST
low complexity region 289 301 N/A INTRINSIC
coiled coil region 428 642 N/A INTRINSIC
coiled coil region 691 734 N/A INTRINSIC
coiled coil region 773 953 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000163660
SMART Domains Protein: ENSMUSP00000128733
Gene: ENSMUSG00000027550

DomainStartEndE-ValueType
Blast:LRR 8 29 7e-6 BLAST
SCOP:d1dcea3 9 71 9e-4 SMART
low complexity region 167 179 N/A INTRINSIC
coiled coil region 306 520 N/A INTRINSIC
coiled coil region 569 612 N/A INTRINSIC
coiled coil region 651 716 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000165436
AA Change: N114K

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000129430
Gene: ENSMUSG00000027550
AA Change: N114K

DomainStartEndE-ValueType
Pfam:LRR_9 32 154 4e-10 PFAM
Pfam:LRR_6 60 83 1.4e-4 PFAM
Pfam:LRR_4 60 103 6.2e-11 PFAM
Pfam:LRR_8 60 116 8.1e-11 PFAM
Pfam:LRR_1 61 81 3.3e-4 PFAM
Pfam:LRR_6 78 105 3.4e-3 PFAM
Pfam:LRR_4 82 125 4.9e-9 PFAM
Pfam:LRR_6 103 125 5.1e-4 PFAM
Pfam:LRR_4 104 149 1.2e-8 PFAM
Pfam:LRR_1 105 128 3.8e-3 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000169079
AA Change: N114K

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000126560
Gene: ENSMUSG00000027550
AA Change: N114K

DomainStartEndE-ValueType
Pfam:LRR_4 60 102 4.3e-9 PFAM
internal_repeat_1 109 145 1.05e-6 PROSPERO
low complexity region 289 301 N/A INTRINSIC
coiled coil region 428 642 N/A INTRINSIC
coiled coil region 691 734 N/A INTRINSIC
coiled coil region 773 1026 N/A INTRINSIC
Meta Mutation Damage Score 0.6467 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.5%
  • 10x: 97.0%
  • 20x: 94.1%
Validation Efficiency 96% (53/55)
Allele List at MGI
Other mutations in this stock
Total: 53 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca12 A T 1: 71,258,105 S2409T probably damaging Het
Acap2 A G 16: 31,139,640 F120S probably damaging Het
Akr1c6 A G 13: 4,434,478 probably null Het
Bptf C A 11: 107,072,747 A1874S probably damaging Het
Ccnl1 A G 3: 65,948,752 V244A probably damaging Het
Cenpe T G 3: 135,248,113 L1628R probably damaging Het
Cfap54 A G 10: 93,025,011 probably null Het
Chchd7 T A 4: 3,943,381 probably null Het
Col9a2 C G 4: 121,054,258 R599G probably damaging Het
Crybg2 G T 4: 134,072,614 V362L probably benign Het
Ddx11 T A 17: 66,149,973 V791E probably damaging Het
Disp1 G A 1: 183,087,167 P1230S probably benign Het
Elp5 T C 11: 69,975,102 H116R probably benign Het
Epb42 T C 2: 121,029,987 E177G possibly damaging Het
F13a1 T A 13: 36,943,997 I336F possibly damaging Het
Fabp3 C T 4: 130,312,387 T57I probably benign Het
Fuk A G 8: 110,889,724 M453T probably benign Het
Hacd2 A T 16: 35,106,378 E249V probably benign Het
Hnrnpf C A 6: 117,924,868 A371D possibly damaging Het
Jmjd1c A G 10: 67,229,904 T1703A probably damaging Het
Kcnj13 G A 1: 87,386,900 T200I possibly damaging Het
Kif1b G A 4: 149,220,620 T949M possibly damaging Het
Klhl35 G A 7: 99,473,824 A552T possibly damaging Het
Krt74 A G 15: 101,756,801 noncoding transcript Het
Krtap14 T A 16: 88,825,709 probably null Het
Lrrc45 A G 11: 120,719,539 N492S probably benign Het
Mfsd2b T C 12: 4,865,164 D375G possibly damaging Het
Mgat4a A G 1: 37,498,704 L44P probably damaging Het
Mttp A C 3: 138,095,021 D774E probably damaging Het
Myo5a T C 9: 75,209,239 V1554A probably benign Het
Nes C T 3: 87,975,943 A503V probably benign Het
Nme8 A G 13: 19,688,943 probably null Het
Nr4a1 A G 15: 101,274,194 D583G possibly damaging Het
Olfr109 A G 17: 37,466,419 Y71C probably damaging Het
Olfr177 A G 16: 58,872,434 S239P probably damaging Het
Pnpla8 T A 12: 44,311,504 L746I probably damaging Het
Ppp1r7 A T 1: 93,354,341 I205F probably benign Het
Psd4 C A 2: 24,394,667 P181Q probably damaging Het
Ripor2 G A 13: 24,706,223 V694I probably benign Het
Scn10a A G 9: 119,627,202 S1185P possibly damaging Het
Sec23b T A 2: 144,585,587 probably null Het
Slfn2 A G 11: 83,065,328 N12S possibly damaging Het
Slfn4 A G 11: 83,185,422 K38R possibly damaging Het
Smarca2 G T 19: 26,640,650 probably null Het
Taar4 A G 10: 23,961,274 T261A possibly damaging Het
Tbl2 A G 5: 135,156,514 D159G probably benign Het
Tmem120a T C 5: 135,742,038 E55G probably damaging Het
Ttc21b A G 2: 66,207,450 probably null Het
Vill A T 9: 119,067,560 probably benign Het
Vmn2r28 A T 7: 5,484,131 M511K probably damaging Het
Vmn2r81 A T 10: 79,274,682 D543V probably damaging Het
Wdr95 A G 5: 149,580,670 T314A probably benign Het
Zbtb8b A G 4: 129,433,189 I61T probably damaging Het
Other mutations in Lrrcc1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00978:Lrrcc1 APN 3 14536128 missense possibly damaging 0.91
IGL01325:Lrrcc1 APN 3 14536541 critical splice donor site probably null
IGL01681:Lrrcc1 APN 3 14548226 missense probably benign 0.35
IGL01767:Lrrcc1 APN 3 14547272 missense probably damaging 0.97
IGL01868:Lrrcc1 APN 3 14554357 nonsense probably null
IGL03123:Lrrcc1 APN 3 14536084 missense probably damaging 0.97
PIT1430001:Lrrcc1 UTSW 3 14545596 missense probably damaging 0.99
R0295:Lrrcc1 UTSW 3 14565849 missense probably benign 0.05
R0427:Lrrcc1 UTSW 3 14558356 missense probably damaging 1.00
R0433:Lrrcc1 UTSW 3 14559374 missense probably damaging 1.00
R0534:Lrrcc1 UTSW 3 14557273 missense probably damaging 1.00
R0631:Lrrcc1 UTSW 3 14540119 splice site probably benign
R0635:Lrrcc1 UTSW 3 14559228 missense probably benign 0.11
R1355:Lrrcc1 UTSW 3 14548114 missense probably benign 0.07
R1370:Lrrcc1 UTSW 3 14548114 missense probably benign 0.07
R1727:Lrrcc1 UTSW 3 14537363 missense probably damaging 0.99
R1822:Lrrcc1 UTSW 3 14559225 unclassified probably benign
R1946:Lrrcc1 UTSW 3 14550393 missense probably benign 0.02
R2254:Lrrcc1 UTSW 3 14547255 missense probably damaging 1.00
R2362:Lrrcc1 UTSW 3 14563024 missense probably damaging 1.00
R4105:Lrrcc1 UTSW 3 14550328 missense probably benign 0.21
R4464:Lrrcc1 UTSW 3 14557318 missense probably damaging 1.00
R4484:Lrrcc1 UTSW 3 14551443 missense probably damaging 1.00
R4543:Lrrcc1 UTSW 3 14539791 missense probably damaging 0.98
R4718:Lrrcc1 UTSW 3 14536032 missense probably damaging 1.00
R4734:Lrrcc1 UTSW 3 14562285 missense probably damaging 1.00
R4799:Lrrcc1 UTSW 3 14536096 nonsense probably null
R4841:Lrrcc1 UTSW 3 14562511 missense probably benign 0.04
R4842:Lrrcc1 UTSW 3 14562511 missense probably benign 0.04
R5900:Lrrcc1 UTSW 3 14562126 missense possibly damaging 0.69
R6338:Lrrcc1 UTSW 3 14547316 missense possibly damaging 0.48
R7001:Lrrcc1 UTSW 3 14540095 missense probably damaging 0.99
R7036:Lrrcc1 UTSW 3 14563009 missense possibly damaging 0.80
R7342:Lrrcc1 UTSW 3 14554371 missense probably benign
R8038:Lrrcc1 UTSW 3 14565830 missense possibly damaging 0.77
Predicted Primers PCR Primer
(F):5'- CCTGCAATTTGATCACAAGAGTGG -3'
(R):5'- CTCAGGTAATATTTTGGCAGCAAC -3'

Sequencing Primer
(F):5'- ATTTGATCACAAGAGTGGAAGGTTTG -3'
(R):5'- GGTAATATTTTGGCAGCAACAAAAG -3'
Posted On2014-11-11