Incidental Mutation 'R2392:Crybg2'
ID247799
Institutional Source Beutler Lab
Gene Symbol Crybg2
Ensembl Gene ENSMUSG00000012123
Gene Namecrystallin beta-gamma domain containing 2
SynonymsAim1l
MMRRC Submission 040360-MU
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.825) question?
Stock #R2392 (G1)
Quality Score225
Status Validated
Chromosome4
Chromosomal Location134060815-134092504 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to T at 134072614 bp
ZygosityHeterozygous
Amino Acid Change Valine to Leucine at position 362 (V362L)
Ref Sequence ENSEMBL: ENSMUSP00000154159 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000121391] [ENSMUST00000137053] [ENSMUST00000219402] [ENSMUST00000227683]
Predicted Effect probably benign
Transcript: ENSMUST00000121391
AA Change: V53L

PolyPhen 2 Score 0.003 (Sensitivity: 0.98; Specificity: 0.44)
SMART Domains Protein: ENSMUSP00000114099
Gene: ENSMUSG00000012123
AA Change: V53L

DomainStartEndE-ValueType
low complexity region 171 205 N/A INTRINSIC
low complexity region 210 226 N/A INTRINSIC
low complexity region 414 443 N/A INTRINSIC
low complexity region 560 582 N/A INTRINSIC
low complexity region 608 625 N/A INTRINSIC
coiled coil region 683 703 N/A INTRINSIC
low complexity region 812 824 N/A INTRINSIC
XTALbg 842 921 2.56e-7 SMART
XTALbg 929 1010 9.33e-10 SMART
XTALbg 1024 1110 5.06e-29 SMART
XTALbg 1118 1199 1.4e-22 SMART
XTALbg 1212 1291 2.22e-16 SMART
XTALbg 1299 1379 1.69e-16 SMART
RICIN 1383 1514 7.89e-2 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000137053
AA Change: V53L

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
Predicted Effect probably benign
Transcript: ENSMUST00000219402
Predicted Effect probably benign
Transcript: ENSMUST00000227683
AA Change: V362L

PolyPhen 2 Score 0.007 (Sensitivity: 0.96; Specificity: 0.75)
Meta Mutation Damage Score 0.0898 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.5%
  • 10x: 97.0%
  • 20x: 94.1%
Validation Efficiency 96% (53/55)
Allele List at MGI
Other mutations in this stock
Total: 53 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca12 A T 1: 71,258,105 S2409T probably damaging Het
Acap2 A G 16: 31,139,640 F120S probably damaging Het
Akr1c6 A G 13: 4,434,478 probably null Het
Bptf C A 11: 107,072,747 A1874S probably damaging Het
Ccnl1 A G 3: 65,948,752 V244A probably damaging Het
Cenpe T G 3: 135,248,113 L1628R probably damaging Het
Cfap54 A G 10: 93,025,011 probably null Het
Chchd7 T A 4: 3,943,381 probably null Het
Col9a2 C G 4: 121,054,258 R599G probably damaging Het
Ddx11 T A 17: 66,149,973 V791E probably damaging Het
Disp1 G A 1: 183,087,167 P1230S probably benign Het
Elp5 T C 11: 69,975,102 H116R probably benign Het
Epb42 T C 2: 121,029,987 E177G possibly damaging Het
F13a1 T A 13: 36,943,997 I336F possibly damaging Het
Fabp3 C T 4: 130,312,387 T57I probably benign Het
Fuk A G 8: 110,889,724 M453T probably benign Het
Hacd2 A T 16: 35,106,378 E249V probably benign Het
Hnrnpf C A 6: 117,924,868 A371D possibly damaging Het
Jmjd1c A G 10: 67,229,904 T1703A probably damaging Het
Kcnj13 G A 1: 87,386,900 T200I possibly damaging Het
Kif1b G A 4: 149,220,620 T949M possibly damaging Het
Klhl35 G A 7: 99,473,824 A552T possibly damaging Het
Krt74 A G 15: 101,756,801 noncoding transcript Het
Krtap14 T A 16: 88,825,709 probably null Het
Lrrc45 A G 11: 120,719,539 N492S probably benign Het
Lrrcc1 T A 3: 14,536,520 N114K probably damaging Het
Mfsd2b T C 12: 4,865,164 D375G possibly damaging Het
Mgat4a A G 1: 37,498,704 L44P probably damaging Het
Mttp A C 3: 138,095,021 D774E probably damaging Het
Myo5a T C 9: 75,209,239 V1554A probably benign Het
Nes C T 3: 87,975,943 A503V probably benign Het
Nme8 A G 13: 19,688,943 probably null Het
Nr4a1 A G 15: 101,274,194 D583G possibly damaging Het
Olfr109 A G 17: 37,466,419 Y71C probably damaging Het
Olfr177 A G 16: 58,872,434 S239P probably damaging Het
Pnpla8 T A 12: 44,311,504 L746I probably damaging Het
Ppp1r7 A T 1: 93,354,341 I205F probably benign Het
Psd4 C A 2: 24,394,667 P181Q probably damaging Het
Ripor2 G A 13: 24,706,223 V694I probably benign Het
Scn10a A G 9: 119,627,202 S1185P possibly damaging Het
Sec23b T A 2: 144,585,587 probably null Het
Slfn2 A G 11: 83,065,328 N12S possibly damaging Het
Slfn4 A G 11: 83,185,422 K38R possibly damaging Het
Smarca2 G T 19: 26,640,650 probably null Het
Taar4 A G 10: 23,961,274 T261A possibly damaging Het
Tbl2 A G 5: 135,156,514 D159G probably benign Het
Tmem120a T C 5: 135,742,038 E55G probably damaging Het
Ttc21b A G 2: 66,207,450 probably null Het
Vill A T 9: 119,067,560 probably benign Het
Vmn2r28 A T 7: 5,484,131 M511K probably damaging Het
Vmn2r81 A T 10: 79,274,682 D543V probably damaging Het
Wdr95 A G 5: 149,580,670 T314A probably benign Het
Zbtb8b A G 4: 129,433,189 I61T probably damaging Het
Other mutations in Crybg2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01083:Crybg2 APN 4 134075444 missense possibly damaging 0.57
IGL01147:Crybg2 APN 4 134089264 splice site probably null
IGL02003:Crybg2 APN 4 134072456 missense probably benign
IGL02468:Crybg2 APN 4 134082587 missense probably damaging 1.00
R0089:Crybg2 UTSW 4 134081194 missense probably damaging 1.00
R0414:Crybg2 UTSW 4 134072636 small deletion probably benign
R0579:Crybg2 UTSW 4 134072738 missense probably damaging 0.97
R0634:Crybg2 UTSW 4 134075304 splice site probably benign
R0638:Crybg2 UTSW 4 134074454 missense probably damaging 1.00
R0686:Crybg2 UTSW 4 134074526 small deletion probably benign
R1583:Crybg2 UTSW 4 134081459 missense probably damaging 1.00
R1651:Crybg2 UTSW 4 134074825 missense possibly damaging 0.84
R1651:Crybg2 UTSW 4 134074903 missense probably benign 0.07
R1752:Crybg2 UTSW 4 134073650 missense probably damaging 0.96
R1883:Crybg2 UTSW 4 134074283 nonsense probably null
R1903:Crybg2 UTSW 4 134078856 missense probably damaging 1.00
R2042:Crybg2 UTSW 4 134087533 missense possibly damaging 0.89
R2081:Crybg2 UTSW 4 134088820 missense possibly damaging 0.82
R2229:Crybg2 UTSW 4 134074526 small deletion probably benign
R2321:Crybg2 UTSW 4 134074511 missense probably benign 0.38
R2939:Crybg2 UTSW 4 134082434 missense possibly damaging 0.46
R2940:Crybg2 UTSW 4 134082434 missense possibly damaging 0.46
R3028:Crybg2 UTSW 4 134073784 missense probably benign 0.19
R4458:Crybg2 UTSW 4 134074894 missense probably benign 0.32
R4487:Crybg2 UTSW 4 134074201 missense probably benign 0.00
R4680:Crybg2 UTSW 4 134072718 frame shift probably null
R4681:Crybg2 UTSW 4 134072718 frame shift probably null
R4682:Crybg2 UTSW 4 134072718 frame shift probably null
R4766:Crybg2 UTSW 4 134089352 missense probably damaging 1.00
R5079:Crybg2 UTSW 4 134074253 missense possibly damaging 0.83
R5291:Crybg2 UTSW 4 134073427 missense probably benign 0.00
R5453:Crybg2 UTSW 4 134078836 critical splice acceptor site probably null
R5711:Crybg2 UTSW 4 134082627 missense probably damaging 0.97
R5834:Crybg2 UTSW 4 134074123 missense probably benign 0.12
R5969:Crybg2 UTSW 4 134075692 splice site probably null
R5976:Crybg2 UTSW 4 134074526 small deletion probably benign
R6022:Crybg2 UTSW 4 134074273 nonsense probably null
R6046:Crybg2 UTSW 4 134092077 missense probably damaging 1.00
R6088:Crybg2 UTSW 4 134075790 unclassified probably null
R6196:Crybg2 UTSW 4 134081139 missense probably damaging 0.99
R6246:Crybg2 UTSW 4 134089346 missense probably damaging 0.96
R6303:Crybg2 UTSW 4 134087587 missense possibly damaging 0.66
R6320:Crybg2 UTSW 4 134081426 missense probably damaging 1.00
R6354:Crybg2 UTSW 4 134091136 missense probably benign 0.39
R6737:Crybg2 UTSW 4 134072690 missense probably damaging 0.99
R6744:Crybg2 UTSW 4 134088896 missense probably damaging 1.00
R6847:Crybg2 UTSW 4 134065546 missense probably benign 0.40
R6891:Crybg2 UTSW 4 134081837 missense probably benign 0.32
R7043:Crybg2 UTSW 4 134091136 missense probably benign 0.39
R7133:Crybg2 UTSW 4 134065443 missense probably benign 0.09
R7166:Crybg2 UTSW 4 134060882 missense probably damaging 0.96
R7412:Crybg2 UTSW 4 134074123 missense probably benign 0.12
R7711:Crybg2 UTSW 4 134065533 missense probably benign 0.00
X0064:Crybg2 UTSW 4 134089276 missense probably damaging 0.98
Predicted Primers PCR Primer
(F):5'- AACTATCGGTAGGGAGCCAGTC -3'
(R):5'- TTCAGTTCTAGGAGCCTGGG -3'

Sequencing Primer
(F):5'- CCAGTCCACAGGGTGACAAG -3'
(R):5'- CAATCCGCAGCCTCCTG -3'
Posted On2014-11-11