Incidental Mutation 'R2392:Kif1b'
ID247800
Institutional Source Beutler Lab
Gene Symbol Kif1b
Ensembl Gene ENSMUSG00000063077
Gene Namekinesin family member 1B
SynonymsKif1b beta, KIF1Bp130, A530096N05Rik, D4Mil1e, Kif1b alpha, N-3 kinesin, KIF1Bp204
MMRRC Submission 040360-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R2392 (G1)
Quality Score225
Status Validated
Chromosome4
Chromosomal Location149176319-149307693 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to A at 149220620 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Methionine at position 949 (T949M)
Ref Sequence ENSEMBL: ENSMUSP00000056754 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000055647] [ENSMUST00000060537]
Predicted Effect possibly damaging
Transcript: ENSMUST00000055647
AA Change: T903M

PolyPhen 2 Score 0.848 (Sensitivity: 0.83; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000061472
Gene: ENSMUSG00000063077
AA Change: T903M

DomainStartEndE-ValueType
KISc 3 356 5.85e-176 SMART
low complexity region 389 404 N/A INTRINSIC
FHA 509 566 1.61e-4 SMART
coiled coil region 626 685 N/A INTRINSIC
Pfam:KIF1B 799 846 9.7e-13 PFAM
internal_repeat_1 901 933 7.01e-7 PROSPERO
low complexity region 1165 1179 N/A INTRINSIC
Pfam:DUF3694 1220 1368 1.1e-46 PFAM
low complexity region 1444 1461 N/A INTRINSIC
low complexity region 1479 1507 N/A INTRINSIC
low complexity region 1573 1591 N/A INTRINSIC
PH 1656 1755 1.02e-14 SMART
Predicted Effect possibly damaging
Transcript: ENSMUST00000060537
AA Change: T949M

PolyPhen 2 Score 0.931 (Sensitivity: 0.81; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000056754
Gene: ENSMUSG00000063077
AA Change: T949M

DomainStartEndE-ValueType
KISc 3 362 7.61e-175 SMART
low complexity region 390 400 N/A INTRINSIC
low complexity region 432 450 N/A INTRINSIC
FHA 555 612 1.61e-4 SMART
coiled coil region 672 731 N/A INTRINSIC
Pfam:KIF1B 845 892 7.1e-15 PFAM
internal_repeat_1 947 979 4.76e-7 PROSPERO
low complexity region 1211 1225 N/A INTRINSIC
Pfam:DUF3694 1266 1413 1.1e-40 PFAM
low complexity region 1490 1507 N/A INTRINSIC
low complexity region 1525 1553 N/A INTRINSIC
low complexity region 1619 1637 N/A INTRINSIC
PH 1702 1801 1.02e-14 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000133526
Meta Mutation Damage Score 0.0621 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.5%
  • 10x: 97.0%
  • 20x: 94.1%
Validation Efficiency 96% (53/55)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a motor protein that transports mitochondria and synaptic vesicle precursors. Mutations in this gene cause Charcot-Marie-Tooth disease, type 2A1. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygotes for a targeted null mutation exhibit reduced brain size, elevated pain threshold, and neonatal death from apnea. Heterozygotes exhibit impaired synaptic vesicle precursor transport and progressive muscle weakness. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 53 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca12 A T 1: 71,258,105 S2409T probably damaging Het
Acap2 A G 16: 31,139,640 F120S probably damaging Het
Akr1c6 A G 13: 4,434,478 probably null Het
Bptf C A 11: 107,072,747 A1874S probably damaging Het
Ccnl1 A G 3: 65,948,752 V244A probably damaging Het
Cenpe T G 3: 135,248,113 L1628R probably damaging Het
Cfap54 A G 10: 93,025,011 probably null Het
Chchd7 T A 4: 3,943,381 probably null Het
Col9a2 C G 4: 121,054,258 R599G probably damaging Het
Crybg2 G T 4: 134,072,614 V362L probably benign Het
Ddx11 T A 17: 66,149,973 V791E probably damaging Het
Disp1 G A 1: 183,087,167 P1230S probably benign Het
Elp5 T C 11: 69,975,102 H116R probably benign Het
Epb42 T C 2: 121,029,987 E177G possibly damaging Het
F13a1 T A 13: 36,943,997 I336F possibly damaging Het
Fabp3 C T 4: 130,312,387 T57I probably benign Het
Fuk A G 8: 110,889,724 M453T probably benign Het
Hacd2 A T 16: 35,106,378 E249V probably benign Het
Hnrnpf C A 6: 117,924,868 A371D possibly damaging Het
Jmjd1c A G 10: 67,229,904 T1703A probably damaging Het
Kcnj13 G A 1: 87,386,900 T200I possibly damaging Het
Klhl35 G A 7: 99,473,824 A552T possibly damaging Het
Krt74 A G 15: 101,756,801 noncoding transcript Het
Krtap14 T A 16: 88,825,709 probably null Het
Lrrc45 A G 11: 120,719,539 N492S probably benign Het
Lrrcc1 T A 3: 14,536,520 N114K probably damaging Het
Mfsd2b T C 12: 4,865,164 D375G possibly damaging Het
Mgat4a A G 1: 37,498,704 L44P probably damaging Het
Mttp A C 3: 138,095,021 D774E probably damaging Het
Myo5a T C 9: 75,209,239 V1554A probably benign Het
Nes C T 3: 87,975,943 A503V probably benign Het
Nme8 A G 13: 19,688,943 probably null Het
Nr4a1 A G 15: 101,274,194 D583G possibly damaging Het
Olfr109 A G 17: 37,466,419 Y71C probably damaging Het
Olfr177 A G 16: 58,872,434 S239P probably damaging Het
Pnpla8 T A 12: 44,311,504 L746I probably damaging Het
Ppp1r7 A T 1: 93,354,341 I205F probably benign Het
Psd4 C A 2: 24,394,667 P181Q probably damaging Het
Ripor2 G A 13: 24,706,223 V694I probably benign Het
Scn10a A G 9: 119,627,202 S1185P possibly damaging Het
Sec23b T A 2: 144,585,587 probably null Het
Slfn2 A G 11: 83,065,328 N12S possibly damaging Het
Slfn4 A G 11: 83,185,422 K38R possibly damaging Het
Smarca2 G T 19: 26,640,650 probably null Het
Taar4 A G 10: 23,961,274 T261A possibly damaging Het
Tbl2 A G 5: 135,156,514 D159G probably benign Het
Tmem120a T C 5: 135,742,038 E55G probably damaging Het
Ttc21b A G 2: 66,207,450 probably null Het
Vill A T 9: 119,067,560 probably benign Het
Vmn2r28 A T 7: 5,484,131 M511K probably damaging Het
Vmn2r81 A T 10: 79,274,682 D543V probably damaging Het
Wdr95 A G 5: 149,580,670 T314A probably benign Het
Zbtb8b A G 4: 129,433,189 I61T probably damaging Het
Other mutations in Kif1b
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01311:Kif1b APN 4 149220602 missense probably damaging 1.00
IGL01943:Kif1b APN 4 149214905 critical splice donor site probably null
IGL02240:Kif1b APN 4 149246414 missense probably damaging 1.00
IGL02414:Kif1b APN 4 149199314 missense probably damaging 0.96
IGL02490:Kif1b APN 4 149204208 missense probably benign
IGL02501:Kif1b APN 4 149214976 missense probably damaging 1.00
IGL02833:Kif1b APN 4 149246364 missense probably damaging 1.00
IGL02852:Kif1b APN 4 149291328 missense probably damaging 1.00
IGL02900:Kif1b APN 4 149180809 missense possibly damaging 0.81
IGL03287:Kif1b APN 4 149214981 missense possibly damaging 0.67
IGL03412:Kif1b APN 4 149274939 missense probably benign 0.00
PIT4305001:Kif1b UTSW 4 149220792 critical splice acceptor site probably null
R0005:Kif1b UTSW 4 149181927 missense probably damaging 1.00
R0044:Kif1b UTSW 4 149263601 splice site probably benign
R0044:Kif1b UTSW 4 149263601 splice site probably benign
R0129:Kif1b UTSW 4 149261201 missense probably benign
R0180:Kif1b UTSW 4 149213659 missense probably damaging 1.00
R0288:Kif1b UTSW 4 149199338 missense probably damaging 1.00
R0360:Kif1b UTSW 4 149262729 missense probably damaging 1.00
R0383:Kif1b UTSW 4 149202512 missense probably damaging 1.00
R0398:Kif1b UTSW 4 149204231 missense possibly damaging 0.89
R0403:Kif1b UTSW 4 149181967 nonsense probably null
R0445:Kif1b UTSW 4 149188009 missense probably benign 0.01
R1466:Kif1b UTSW 4 149223252 missense probably damaging 0.99
R1466:Kif1b UTSW 4 149223252 missense probably damaging 0.99
R1681:Kif1b UTSW 4 149195501 critical splice acceptor site probably null
R1728:Kif1b UTSW 4 149187722 missense probably damaging 0.99
R1840:Kif1b UTSW 4 149188132 missense probably damaging 1.00
R1874:Kif1b UTSW 4 149187632 missense probably benign
R1915:Kif1b UTSW 4 149267216 missense probably damaging 1.00
R2106:Kif1b UTSW 4 149187640 missense possibly damaging 0.92
R2124:Kif1b UTSW 4 149222296 missense probably benign 0.08
R2126:Kif1b UTSW 4 149187640 missense possibly damaging 0.92
R2127:Kif1b UTSW 4 149187640 missense possibly damaging 0.92
R2128:Kif1b UTSW 4 149187640 missense possibly damaging 0.92
R2129:Kif1b UTSW 4 149187640 missense possibly damaging 0.92
R2146:Kif1b UTSW 4 149184309 missense probably damaging 0.99
R2255:Kif1b UTSW 4 149274997 missense probably damaging 1.00
R2883:Kif1b UTSW 4 149237648 missense possibly damaging 0.78
R2981:Kif1b UTSW 4 149220541 critical splice donor site probably null
R3038:Kif1b UTSW 4 149213333 missense probably benign 0.02
R3616:Kif1b UTSW 4 149262283 splice site probably benign
R3935:Kif1b UTSW 4 149237160 missense probably benign 0.00
R4347:Kif1b UTSW 4 149247234 missense probably damaging 1.00
R4423:Kif1b UTSW 4 149214105 missense probably damaging 0.99
R4637:Kif1b UTSW 4 149199311 missense probably damaging 0.97
R4745:Kif1b UTSW 4 149237882 nonsense probably null
R4807:Kif1b UTSW 4 149247921 intron probably benign
R5618:Kif1b UTSW 4 149269889 missense possibly damaging 0.94
R5644:Kif1b UTSW 4 149238482 missense probably damaging 0.96
R5683:Kif1b UTSW 4 149222261 missense probably damaging 1.00
R5696:Kif1b UTSW 4 149273849 splice site probably null
R6022:Kif1b UTSW 4 149198532 missense probably benign 0.01
R6048:Kif1b UTSW 4 149263629 missense probably damaging 1.00
R6137:Kif1b UTSW 4 149238426 missense possibly damaging 0.47
R6139:Kif1b UTSW 4 149237532 missense possibly damaging 0.88
R6171:Kif1b UTSW 4 149258048 missense probably damaging 1.00
R6250:Kif1b UTSW 4 149213643 missense probably benign 0.00
R6423:Kif1b UTSW 4 149192596 missense probably benign 0.16
R6424:Kif1b UTSW 4 149192596 missense probably benign 0.16
R6425:Kif1b UTSW 4 149192596 missense probably benign 0.16
R6443:Kif1b UTSW 4 149192596 missense probably benign 0.16
R6460:Kif1b UTSW 4 149192596 missense probably benign 0.16
R6462:Kif1b UTSW 4 149192596 missense probably benign 0.16
R6463:Kif1b UTSW 4 149192596 missense probably benign 0.16
R6469:Kif1b UTSW 4 149192596 missense probably benign 0.16
R6470:Kif1b UTSW 4 149192596 missense probably benign 0.16
R6471:Kif1b UTSW 4 149192596 missense probably benign 0.16
R6472:Kif1b UTSW 4 149192596 missense probably benign 0.16
R6504:Kif1b UTSW 4 149192596 missense probably benign 0.16
R6536:Kif1b UTSW 4 149192596 missense probably benign 0.16
R6537:Kif1b UTSW 4 149192596 missense probably benign 0.16
R6668:Kif1b UTSW 4 149213407 missense probably benign 0.09
R6698:Kif1b UTSW 4 149274956 missense probably damaging 0.99
R7065:Kif1b UTSW 4 149202525 missense possibly damaging 0.46
R7222:Kif1b UTSW 4 149225157 missense probably damaging 1.00
R7342:Kif1b UTSW 4 149214090 missense possibly damaging 0.94
R7720:Kif1b UTSW 4 149182355 missense probably benign 0.01
R7744:Kif1b UTSW 4 149237075 missense possibly damaging 0.83
R7797:Kif1b UTSW 4 149237387 missense probably benign
R7829:Kif1b UTSW 4 149220990 splice site probably null
R7869:Kif1b UTSW 4 149184376 missense probably benign 0.01
R7878:Kif1b UTSW 4 149214997 missense probably damaging 0.98
R7980:Kif1b UTSW 4 149269921 missense probably damaging 1.00
R8047:Kif1b UTSW 4 149214922 missense probably damaging 1.00
R8237:Kif1b UTSW 4 149191185 missense probably benign 0.10
R8243:Kif1b UTSW 4 149204267 missense probably benign
R8252:Kif1b UTSW 4 149273805 missense probably damaging 1.00
R8342:Kif1b UTSW 4 149222348 missense probably damaging 0.96
R8460:Kif1b UTSW 4 149187620 missense possibly damaging 0.93
R8462:Kif1b UTSW 4 149182340 missense probably benign 0.05
R8496:Kif1b UTSW 4 149192611 nonsense probably null
R8687:Kif1b UTSW 4 149261163 nonsense probably null
R8694:Kif1b UTSW 4 149220567 missense probably damaging 0.98
R8842:Kif1b UTSW 4 149253739 missense probably damaging 0.98
R8883:Kif1b UTSW 4 149276885 missense probably benign
RF008:Kif1b UTSW 4 149251738 splice site probably null
X0009:Kif1b UTSW 4 149247264 missense probably damaging 1.00
X0062:Kif1b UTSW 4 149275005 missense probably damaging 1.00
Z1176:Kif1b UTSW 4 149266298 missense possibly damaging 0.89
Predicted Primers PCR Primer
(F):5'- AAGGCCTAGGCTTTCTTTCTAGC -3'
(R):5'- TGGGCATCCTGTTAACCGAC -3'

Sequencing Primer
(F):5'- CTTTCTAGCCAAAATTGCACAGAGG -3'
(R):5'- GGGCATCCTGTTAACCGACTATTC -3'
Posted On2014-11-11