Incidental Mutation 'R2392:Taar4'
ID247816
Institutional Source Beutler Lab
Gene Symbol Taar4
Ensembl Gene ENSMUSG00000069707
Gene Nametrace amine-associated receptor 4
Synonyms
MMRRC Submission 040360-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.100) question?
Stock #R2392 (G1)
Quality Score225
Status Validated
Chromosome10
Chromosomal Location23960494-23961537 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 23961274 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Alanine at position 261 (T261A)
Ref Sequence ENSEMBL: ENSMUSP00000090330 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000092660]
Predicted Effect possibly damaging
Transcript: ENSMUST00000092660
AA Change: T261A

PolyPhen 2 Score 0.942 (Sensitivity: 0.80; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000090330
Gene: ENSMUSG00000069707
AA Change: T261A

DomainStartEndE-ValueType
Pfam:7TM_GPCR_Srsx 44 328 9.2e-11 PFAM
Pfam:7tm_1 50 313 4.6e-63 PFAM
Meta Mutation Damage Score 0.1795 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.5%
  • 10x: 97.0%
  • 20x: 94.1%
Validation Efficiency 96% (53/55)
MGI Phenotype PHENOTYPE: Mice homozygous for a knock-out allele exhibit impaired olfactory response and aversion to PEA and puma urine. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 53 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca12 A T 1: 71,258,105 S2409T probably damaging Het
Acap2 A G 16: 31,139,640 F120S probably damaging Het
Akr1c6 A G 13: 4,434,478 probably null Het
Bptf C A 11: 107,072,747 A1874S probably damaging Het
Ccnl1 A G 3: 65,948,752 V244A probably damaging Het
Cenpe T G 3: 135,248,113 L1628R probably damaging Het
Cfap54 A G 10: 93,025,011 probably null Het
Chchd7 T A 4: 3,943,381 probably null Het
Col9a2 C G 4: 121,054,258 R599G probably damaging Het
Crybg2 G T 4: 134,072,614 V362L probably benign Het
Ddx11 T A 17: 66,149,973 V791E probably damaging Het
Disp1 G A 1: 183,087,167 P1230S probably benign Het
Elp5 T C 11: 69,975,102 H116R probably benign Het
Epb42 T C 2: 121,029,987 E177G possibly damaging Het
F13a1 T A 13: 36,943,997 I336F possibly damaging Het
Fabp3 C T 4: 130,312,387 T57I probably benign Het
Fuk A G 8: 110,889,724 M453T probably benign Het
Hacd2 A T 16: 35,106,378 E249V probably benign Het
Hnrnpf C A 6: 117,924,868 A371D possibly damaging Het
Jmjd1c A G 10: 67,229,904 T1703A probably damaging Het
Kcnj13 G A 1: 87,386,900 T200I possibly damaging Het
Kif1b G A 4: 149,220,620 T949M possibly damaging Het
Klhl35 G A 7: 99,473,824 A552T possibly damaging Het
Krt74 A G 15: 101,756,801 noncoding transcript Het
Krtap14 T A 16: 88,825,709 probably null Het
Lrrc45 A G 11: 120,719,539 N492S probably benign Het
Lrrcc1 T A 3: 14,536,520 N114K probably damaging Het
Mfsd2b T C 12: 4,865,164 D375G possibly damaging Het
Mgat4a A G 1: 37,498,704 L44P probably damaging Het
Mttp A C 3: 138,095,021 D774E probably damaging Het
Myo5a T C 9: 75,209,239 V1554A probably benign Het
Nes C T 3: 87,975,943 A503V probably benign Het
Nme8 A G 13: 19,688,943 probably null Het
Nr4a1 A G 15: 101,274,194 D583G possibly damaging Het
Olfr109 A G 17: 37,466,419 Y71C probably damaging Het
Olfr177 A G 16: 58,872,434 S239P probably damaging Het
Pnpla8 T A 12: 44,311,504 L746I probably damaging Het
Ppp1r7 A T 1: 93,354,341 I205F probably benign Het
Psd4 C A 2: 24,394,667 P181Q probably damaging Het
Ripor2 G A 13: 24,706,223 V694I probably benign Het
Scn10a A G 9: 119,627,202 S1185P possibly damaging Het
Sec23b T A 2: 144,585,587 probably null Het
Slfn2 A G 11: 83,065,328 N12S possibly damaging Het
Slfn4 A G 11: 83,185,422 K38R possibly damaging Het
Smarca2 G T 19: 26,640,650 probably null Het
Tbl2 A G 5: 135,156,514 D159G probably benign Het
Tmem120a T C 5: 135,742,038 E55G probably damaging Het
Ttc21b A G 2: 66,207,450 probably null Het
Vill A T 9: 119,067,560 probably benign Het
Vmn2r28 A T 7: 5,484,131 M511K probably damaging Het
Vmn2r81 A T 10: 79,274,682 D543V probably damaging Het
Wdr95 A G 5: 149,580,670 T314A probably benign Het
Zbtb8b A G 4: 129,433,189 I61T probably damaging Het
Other mutations in Taar4
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02576:Taar4 APN 10 23961011 missense probably damaging 1.00
IGL03202:Taar4 APN 10 23960794 missense probably damaging 1.00
I2288:Taar4 UTSW 10 23960920 missense probably benign 0.03
R0103:Taar4 UTSW 10 23961406 missense probably damaging 1.00
R0103:Taar4 UTSW 10 23961406 missense probably damaging 1.00
R0514:Taar4 UTSW 10 23960882 missense probably damaging 1.00
R1222:Taar4 UTSW 10 23961332 missense probably benign 0.05
R1248:Taar4 UTSW 10 23961038 missense possibly damaging 0.95
R1514:Taar4 UTSW 10 23960612 missense possibly damaging 0.71
R1921:Taar4 UTSW 10 23961341 missense probably damaging 1.00
R2074:Taar4 UTSW 10 23961173 missense probably benign 0.18
R2354:Taar4 UTSW 10 23961014 missense probably damaging 1.00
R2698:Taar4 UTSW 10 23961430 missense probably damaging 1.00
R3902:Taar4 UTSW 10 23961015 missense probably damaging 1.00
R4688:Taar4 UTSW 10 23960833 missense probably damaging 1.00
R5495:Taar4 UTSW 10 23961283 missense possibly damaging 0.95
R5595:Taar4 UTSW 10 23960741 missense probably damaging 1.00
R5773:Taar4 UTSW 10 23961158 missense probably damaging 1.00
R7403:Taar4 UTSW 10 23961059 missense probably damaging 1.00
R7581:Taar4 UTSW 10 23961154 missense probably damaging 0.97
Predicted Primers PCR Primer
(F):5'- AACAAGCTCTGGGGAGTTCTG -3'
(R):5'- TGACTATCATCCTCAGGGCC -3'

Sequencing Primer
(F):5'- GGAGTTCTGGCTTCCTTCATAGC -3'
(R):5'- TCAGGGCCTTTCGAAACCAG -3'
Posted On2014-11-11