Incidental Mutation 'R2392:Nme8'
ID247828
Institutional Source Beutler Lab
Gene Symbol Nme8
Ensembl Gene ENSMUSG00000041138
Gene NameNME/NM23 family member 8
SynonymsSptrx-2, 1700056P15Rik, Txndc3
MMRRC Submission 040360-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.112) question?
Stock #R2392 (G1)
Quality Score225
Status Validated
Chromosome13
Chromosomal Location19645078-19697794 bp(-) (GRCm38)
Type of Mutationcritical splice donor site (2 bp from exon)
DNA Base Change (assembly) A to G at 19688943 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000089358 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000039340] [ENSMUST00000091763]
Predicted Effect probably null
Transcript: ENSMUST00000039340
SMART Domains Protein: ENSMUSP00000047052
Gene: ENSMUSG00000041138

DomainStartEndE-ValueType
Pfam:Thioredoxin 11 112 3.7e-12 PFAM
Pfam:NDK 155 283 2.3e-14 PFAM
NDK 312 452 3.8e-28 SMART
Predicted Effect probably null
Transcript: ENSMUST00000091763
SMART Domains Protein: ENSMUSP00000089358
Gene: ENSMUSG00000041138

DomainStartEndE-ValueType
Pfam:Thioredoxin 11 112 6.9e-12 PFAM
Pfam:NDK 155 284 1.1e-13 PFAM
NDK 312 449 2.75e-25 SMART
NDK 450 586 1.45e-33 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000144820
Predicted Effect noncoding transcript
Transcript: ENSMUST00000221343
Predicted Effect noncoding transcript
Transcript: ENSMUST00000223286
Meta Mutation Damage Score 0.9478 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.5%
  • 10x: 97.0%
  • 20x: 94.1%
Validation Efficiency 96% (53/55)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a protein with an N-terminal thioredoxin domain and three C-terminal nucleoside diphosphate kinase (NDK) domains, but the NDK domains are thought to be catalytically inactive. The sea urchin ortholog of this gene encodes a component of sperm outer dynein arms, and the protein is implicated in ciliary function. Mutations in this gene are implicated in primary ciliary dyskinesia type 6.[provided by RefSeq, Nov 2009]
PHENOTYPE: Homozygous mutant displays normal reproductive system phenotype [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 53 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca12 A T 1: 71,258,105 S2409T probably damaging Het
Acap2 A G 16: 31,139,640 F120S probably damaging Het
Akr1c6 A G 13: 4,434,478 probably null Het
Bptf C A 11: 107,072,747 A1874S probably damaging Het
Ccnl1 A G 3: 65,948,752 V244A probably damaging Het
Cenpe T G 3: 135,248,113 L1628R probably damaging Het
Cfap54 A G 10: 93,025,011 probably null Het
Chchd7 T A 4: 3,943,381 probably null Het
Col9a2 C G 4: 121,054,258 R599G probably damaging Het
Crybg2 G T 4: 134,072,614 V362L probably benign Het
Ddx11 T A 17: 66,149,973 V791E probably damaging Het
Disp1 G A 1: 183,087,167 P1230S probably benign Het
Elp5 T C 11: 69,975,102 H116R probably benign Het
Epb42 T C 2: 121,029,987 E177G possibly damaging Het
F13a1 T A 13: 36,943,997 I336F possibly damaging Het
Fabp3 C T 4: 130,312,387 T57I probably benign Het
Fuk A G 8: 110,889,724 M453T probably benign Het
Hacd2 A T 16: 35,106,378 E249V probably benign Het
Hnrnpf C A 6: 117,924,868 A371D possibly damaging Het
Jmjd1c A G 10: 67,229,904 T1703A probably damaging Het
Kcnj13 G A 1: 87,386,900 T200I possibly damaging Het
Kif1b G A 4: 149,220,620 T949M possibly damaging Het
Klhl35 G A 7: 99,473,824 A552T possibly damaging Het
Krt74 A G 15: 101,756,801 noncoding transcript Het
Krtap14 T A 16: 88,825,709 probably null Het
Lrrc45 A G 11: 120,719,539 N492S probably benign Het
Lrrcc1 T A 3: 14,536,520 N114K probably damaging Het
Mfsd2b T C 12: 4,865,164 D375G possibly damaging Het
Mgat4a A G 1: 37,498,704 L44P probably damaging Het
Mttp A C 3: 138,095,021 D774E probably damaging Het
Myo5a T C 9: 75,209,239 V1554A probably benign Het
Nes C T 3: 87,975,943 A503V probably benign Het
Nr4a1 A G 15: 101,274,194 D583G possibly damaging Het
Olfr109 A G 17: 37,466,419 Y71C probably damaging Het
Olfr177 A G 16: 58,872,434 S239P probably damaging Het
Pnpla8 T A 12: 44,311,504 L746I probably damaging Het
Ppp1r7 A T 1: 93,354,341 I205F probably benign Het
Psd4 C A 2: 24,394,667 P181Q probably damaging Het
Ripor2 G A 13: 24,706,223 V694I probably benign Het
Scn10a A G 9: 119,627,202 S1185P possibly damaging Het
Sec23b T A 2: 144,585,587 probably null Het
Slfn2 A G 11: 83,065,328 N12S possibly damaging Het
Slfn4 A G 11: 83,185,422 K38R possibly damaging Het
Smarca2 G T 19: 26,640,650 probably null Het
Taar4 A G 10: 23,961,274 T261A possibly damaging Het
Tbl2 A G 5: 135,156,514 D159G probably benign Het
Tmem120a T C 5: 135,742,038 E55G probably damaging Het
Ttc21b A G 2: 66,207,450 probably null Het
Vill A T 9: 119,067,560 probably benign Het
Vmn2r28 A T 7: 5,484,131 M511K probably damaging Het
Vmn2r81 A T 10: 79,274,682 D543V probably damaging Het
Wdr95 A G 5: 149,580,670 T314A probably benign Het
Zbtb8b A G 4: 129,433,189 I61T probably damaging Het
Other mutations in Nme8
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01984:Nme8 APN 13 19688980 missense probably damaging 1.00
IGL02272:Nme8 APN 13 19658826 missense probably damaging 0.99
IGL02344:Nme8 APN 13 19674404 missense possibly damaging 0.94
IGL02395:Nme8 APN 13 19677908 missense possibly damaging 0.64
IGL02621:Nme8 APN 13 19675648 missense probably damaging 1.00
IGL02645:Nme8 APN 13 19660585 missense probably damaging 1.00
IGL02807:Nme8 APN 13 19675831 unclassified probably benign
IGL03059:Nme8 APN 13 19652244 missense possibly damaging 0.92
IGL03288:Nme8 APN 13 19696606 missense possibly damaging 0.94
IGL03323:Nme8 APN 13 19688950 missense probably benign 0.06
R0139:Nme8 UTSW 13 19677848 missense probably benign 0.19
R0616:Nme8 UTSW 13 19690859 missense probably benign 0.00
R0632:Nme8 UTSW 13 19658036 missense probably damaging 0.96
R1233:Nme8 UTSW 13 19660512 missense possibly damaging 0.71
R1288:Nme8 UTSW 13 19674449 missense possibly damaging 0.87
R1305:Nme8 UTSW 13 19696907 missense possibly damaging 0.90
R1773:Nme8 UTSW 13 19697036 start codon destroyed probably damaging 1.00
R1942:Nme8 UTSW 13 19675808 missense probably damaging 1.00
R1970:Nme8 UTSW 13 19652322 missense probably damaging 1.00
R2012:Nme8 UTSW 13 19696883 missense probably damaging 1.00
R2093:Nme8 UTSW 13 19650872 missense probably damaging 1.00
R2436:Nme8 UTSW 13 19677859 missense probably damaging 1.00
R2901:Nme8 UTSW 13 19675664 missense probably benign 0.02
R2902:Nme8 UTSW 13 19675664 missense probably benign 0.02
R4665:Nme8 UTSW 13 19674435 missense probably damaging 1.00
R4751:Nme8 UTSW 13 19675638 critical splice donor site probably null
R4785:Nme8 UTSW 13 19657930 missense probably damaging 0.96
R5101:Nme8 UTSW 13 19690847 critical splice donor site probably null
R5217:Nme8 UTSW 13 19696691 missense probably damaging 1.00
R5251:Nme8 UTSW 13 19660625 missense probably benign 0.33
R5356:Nme8 UTSW 13 19652299 missense probably damaging 1.00
R5397:Nme8 UTSW 13 19694379 missense probably damaging 1.00
R5624:Nme8 UTSW 13 19677868 missense possibly damaging 0.94
R6679:Nme8 UTSW 13 19690970 splice site probably null
R7040:Nme8 UTSW 13 19694328 missense probably damaging 1.00
R7111:Nme8 UTSW 13 19675647 missense probably benign 0.06
R7185:Nme8 UTSW 13 19677883 missense probably damaging 1.00
R7670:Nme8 UTSW 13 19658829 missense probably benign 0.01
R7685:Nme8 UTSW 13 19650975 missense probably benign 0.00
Z1088:Nme8 UTSW 13 19688957 missense possibly damaging 0.82
Predicted Primers PCR Primer
(F):5'- ACAATTTCTGCAGGGTGATGG -3'
(R):5'- CCCCGGGTGGAATTCTAATG -3'

Sequencing Primer
(F):5'- TCTGCAGGGTGATGGCAGTAAAG -3'
(R):5'- GTGTGTGTCCTTAAAGCCCAGAC -3'
Posted On2014-11-11