Incidental Mutation 'R2392:Olfr177'
ID247836
Institutional Source Beutler Lab
Gene Symbol Olfr177
Ensembl Gene ENSMUSG00000063137
Gene Nameolfactory receptor 177
SynonymsGA_x54KRFPKG5P-55091371-55090442, MOR184-7
MMRRC Submission 040360-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.064) question?
Stock #R2392 (G1)
Quality Score225
Status Validated
Chromosome16
Chromosomal Location58870955-58874768 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 58872434 bp
ZygosityHeterozygous
Amino Acid Change Serine to Proline at position 239 (S239P)
Ref Sequence ENSEMBL: ENSMUSP00000150269 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000072853] [ENSMUST00000217377]
Predicted Effect probably damaging
Transcript: ENSMUST00000072853
AA Change: S239P

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000072631
Gene: ENSMUSG00000063137
AA Change: S239P

DomainStartEndE-ValueType
Pfam:7tm_4 31 308 2.7e-53 PFAM
Pfam:7TM_GPCR_Srsx 35 254 8.3e-6 PFAM
Pfam:7tm_1 41 290 1.2e-17 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000205920
AA Change: S239P
Predicted Effect probably damaging
Transcript: ENSMUST00000217377
AA Change: S239P

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
Meta Mutation Damage Score 0.5930 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.5%
  • 10x: 97.0%
  • 20x: 94.1%
Validation Efficiency 96% (53/55)
MGI Phenotype FUNCTION: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 53 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca12 A T 1: 71,258,105 S2409T probably damaging Het
Acap2 A G 16: 31,139,640 F120S probably damaging Het
Akr1c6 A G 13: 4,434,478 probably null Het
Bptf C A 11: 107,072,747 A1874S probably damaging Het
Ccnl1 A G 3: 65,948,752 V244A probably damaging Het
Cenpe T G 3: 135,248,113 L1628R probably damaging Het
Cfap54 A G 10: 93,025,011 probably null Het
Chchd7 T A 4: 3,943,381 probably null Het
Col9a2 C G 4: 121,054,258 R599G probably damaging Het
Crybg2 G T 4: 134,072,614 V362L probably benign Het
Ddx11 T A 17: 66,149,973 V791E probably damaging Het
Disp1 G A 1: 183,087,167 P1230S probably benign Het
Elp5 T C 11: 69,975,102 H116R probably benign Het
Epb42 T C 2: 121,029,987 E177G possibly damaging Het
F13a1 T A 13: 36,943,997 I336F possibly damaging Het
Fabp3 C T 4: 130,312,387 T57I probably benign Het
Fuk A G 8: 110,889,724 M453T probably benign Het
Hacd2 A T 16: 35,106,378 E249V probably benign Het
Hnrnpf C A 6: 117,924,868 A371D possibly damaging Het
Jmjd1c A G 10: 67,229,904 T1703A probably damaging Het
Kcnj13 G A 1: 87,386,900 T200I possibly damaging Het
Kif1b G A 4: 149,220,620 T949M possibly damaging Het
Klhl35 G A 7: 99,473,824 A552T possibly damaging Het
Krt74 A G 15: 101,756,801 noncoding transcript Het
Krtap14 T A 16: 88,825,709 probably null Het
Lrrc45 A G 11: 120,719,539 N492S probably benign Het
Lrrcc1 T A 3: 14,536,520 N114K probably damaging Het
Mfsd2b T C 12: 4,865,164 D375G possibly damaging Het
Mgat4a A G 1: 37,498,704 L44P probably damaging Het
Mttp A C 3: 138,095,021 D774E probably damaging Het
Myo5a T C 9: 75,209,239 V1554A probably benign Het
Nes C T 3: 87,975,943 A503V probably benign Het
Nme8 A G 13: 19,688,943 probably null Het
Nr4a1 A G 15: 101,274,194 D583G possibly damaging Het
Olfr109 A G 17: 37,466,419 Y71C probably damaging Het
Pnpla8 T A 12: 44,311,504 L746I probably damaging Het
Ppp1r7 A T 1: 93,354,341 I205F probably benign Het
Psd4 C A 2: 24,394,667 P181Q probably damaging Het
Ripor2 G A 13: 24,706,223 V694I probably benign Het
Scn10a A G 9: 119,627,202 S1185P possibly damaging Het
Sec23b T A 2: 144,585,587 probably null Het
Slfn2 A G 11: 83,065,328 N12S possibly damaging Het
Slfn4 A G 11: 83,185,422 K38R possibly damaging Het
Smarca2 G T 19: 26,640,650 probably null Het
Taar4 A G 10: 23,961,274 T261A possibly damaging Het
Tbl2 A G 5: 135,156,514 D159G probably benign Het
Tmem120a T C 5: 135,742,038 E55G probably damaging Het
Ttc21b A G 2: 66,207,450 probably null Het
Vill A T 9: 119,067,560 probably benign Het
Vmn2r28 A T 7: 5,484,131 M511K probably damaging Het
Vmn2r81 A T 10: 79,274,682 D543V probably damaging Het
Wdr95 A G 5: 149,580,670 T314A probably benign Het
Zbtb8b A G 4: 129,433,189 I61T probably damaging Het
Other mutations in Olfr177
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02084:Olfr177 APN 16 58873036 missense probably damaging 1.00
IGL02223:Olfr177 APN 16 58872694 missense probably damaging 1.00
R0131:Olfr177 UTSW 16 58872906 missense probably benign 0.01
R0131:Olfr177 UTSW 16 58872906 missense probably benign 0.01
R0132:Olfr177 UTSW 16 58872906 missense probably benign 0.01
R0245:Olfr177 UTSW 16 58872866 missense probably benign 0.01
R0717:Olfr177 UTSW 16 58872770 missense probably damaging 1.00
R0975:Olfr177 UTSW 16 58873150 splice site probably null
R1037:Olfr177 UTSW 16 58872970 missense probably damaging 1.00
R1256:Olfr177 UTSW 16 58872843 nonsense probably null
R1278:Olfr177 UTSW 16 58872977 missense probably damaging 1.00
R1538:Olfr177 UTSW 16 58872898 missense probably damaging 1.00
R1992:Olfr177 UTSW 16 58872511 missense probably benign 0.43
R2173:Olfr177 UTSW 16 58872619 missense probably damaging 0.99
R5651:Olfr177 UTSW 16 58872484 missense probably damaging 0.99
R5652:Olfr177 UTSW 16 58872484 missense probably damaging 0.99
R5653:Olfr177 UTSW 16 58872484 missense probably damaging 0.99
R8031:Olfr177 UTSW 16 58872691 missense probably benign 0.03
R8108:Olfr177 UTSW 16 58872236 missense probably benign
R8531:Olfr177 UTSW 16 58872653 missense probably damaging 1.00
R8833:Olfr177 UTSW 16 58872596 missense probably damaging 0.99
V8831:Olfr177 UTSW 16 58873075 missense probably benign 0.28
Predicted Primers PCR Primer
(F):5'- GGTATGGGATCAAAAGTTGCAC -3'
(R):5'- GATGTCCTTCCCCTATACAGAC -3'

Sequencing Primer
(F):5'- ATGCATGCTAATGTGTATTTCTAGG -3'
(R):5'- ATACAGACTCTCATGTGTTGACC -3'
Posted On2014-11-11