Incidental Mutation 'R0299:Vmn1r25'
Institutional Source Beutler Lab
Gene Symbol Vmn1r25
Ensembl Gene ENSMUSG00000115668
Gene Namevomeronasal 1 receptor 25
MMRRC Submission 038513-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.153) question?
Stock #R0299 (G1)
Quality Score225
Status Validated
Chromosomal Location57978299-57980810 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 57978509 bp
Amino Acid Change Glutamine to Leucine at position 265 (Q265L)
Ref Sequence ENSEMBL: ENSMUSP00000154074 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000176572] [ENSMUST00000228585]
Predicted Effect probably damaging
Transcript: ENSMUST00000176572
AA Change: Q265L

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000135860
Gene: ENSMUSG00000115668
AA Change: Q265L

Pfam:V1R 29 293 5.4e-52 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000228585
AA Change: Q265L

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
Meta Mutation Damage Score 0.6467 question?
Coding Region Coverage
  • 1x: 98.8%
  • 3x: 97.8%
  • 10x: 95.3%
  • 20x: 90.1%
Validation Efficiency 100% (61/61)
Allele List at MGI
Other mutations in this stock
Total: 62 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930503L19Rik G A 18: 70,469,482 Q87* probably null Het
4933427I04Rik A T 4: 123,860,822 R176S possibly damaging Het
A2ml1 T G 6: 128,553,232 probably benign Het
Abca13 G A 11: 9,298,076 E2608K probably benign Het
Acpp T C 9: 104,320,002 E146G probably damaging Het
Adcy8 T A 15: 64,716,166 D894V probably damaging Het
Ap4b1 T C 3: 103,809,946 M1T probably null Het
Arg2 A G 12: 79,147,612 D70G probably damaging Het
Atxn1 A G 13: 45,567,169 S417P probably damaging Het
Btbd10 A T 7: 113,329,878 S230T possibly damaging Het
Carmil1 T A 13: 24,082,020 N253I probably damaging Het
Celf6 C A 9: 59,602,878 T86K probably benign Het
Clec2h T C 6: 128,670,895 V69A probably damaging Het
Col15a1 A T 4: 47,262,950 D534V probably damaging Het
Col16a1 TCCCC TCCC 4: 130,058,318 probably null Het
Degs1 A T 1: 182,279,271 I141N probably damaging Het
Dnah1 C T 14: 31,276,158 G2574D probably damaging Het
Dnah8 T A 17: 30,715,509 F1489L possibly damaging Het
Dock10 T C 1: 80,536,929 R1424G probably damaging Het
Elp2 T C 18: 24,634,409 I716T probably benign Het
Frk T C 10: 34,484,371 probably null Het
Fshr C G 17: 89,009,285 S169T probably benign Het
Gin1 T A 1: 97,783,016 S141R possibly damaging Het
Gm11596 G A 11: 99,792,944 P117S unknown Het
Gm6327 T C 16: 12,761,197 noncoding transcript Het
Hepacam2 A G 6: 3,476,121 L268P probably damaging Het
Hps6 G A 19: 46,004,232 V203M probably damaging Het
Hsd17b7 G A 1: 169,959,794 probably benign Het
Il18rap A T 1: 40,525,058 H112L probably benign Het
Il1r2 T A 1: 40,123,149 Y317* probably null Het
Ints8 C A 4: 11,246,097 V190L probably benign Het
Me2 A G 18: 73,770,673 S575P probably benign Het
Mecom A G 3: 29,980,411 L372P probably benign Het
Mss51 T A 14: 20,484,688 Q338L possibly damaging Het
Muc2 C T 7: 141,752,729 T296I probably damaging Het
Muc4 A T 16: 32,750,195 probably benign Het
Neto1 G A 18: 86,461,320 R211Q probably benign Het
Nisch A G 14: 31,171,924 Y1231H probably damaging Het
Olfr1331 A G 4: 118,869,416 I212V probably benign Het
Olfr1338 A T 4: 118,754,535 M1K probably null Het
Pcsk6 T C 7: 66,039,043 V820A probably benign Het
Pdcd10 T C 3: 75,527,651 K111R probably damaging Het
Pdgfrb T A 18: 61,068,852 V496E probably benign Het
Pelo A T 13: 115,088,903 C40* probably null Het
Plxnc1 C T 10: 94,849,821 probably null Het
Ptpru G A 4: 131,803,387 Q519* probably null Het
Pzp A G 6: 128,495,330 probably benign Het
Rad21 A T 15: 51,965,030 D547E probably benign Het
Serpina1d A T 12: 103,765,757 L281Q probably damaging Het
Serpina9 T C 12: 104,001,470 N222S probably benign Het
Sh3bgrl2 A G 9: 83,577,559 K57E probably damaging Het
Shtn1 T C 19: 59,018,951 E289G probably benign Het
Sik3 T C 9: 46,208,740 M659T possibly damaging Het
Slamf7 G A 1: 171,648,931 probably benign Het
Sppl3 T A 5: 115,088,994 probably benign Het
Suco G A 1: 161,853,810 T253I probably benign Het
Tecta T C 9: 42,352,063 D1409G probably damaging Het
Tram2 T C 1: 21,004,244 D238G probably damaging Het
Trpm3 T C 19: 22,986,873 M1244T possibly damaging Het
Trub1 A G 19: 57,483,625 T178A possibly damaging Het
Ugcg G C 4: 59,217,036 V187L possibly damaging Het
Zfp821 G T 8: 109,724,230 R285L probably damaging Het
Other mutations in Vmn1r25
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01867:Vmn1r25 APN 6 57979211 missense probably damaging 0.99
R0401:Vmn1r25 UTSW 6 57978711 missense probably benign 0.01
R0499:Vmn1r25 UTSW 6 57978509 missense probably damaging 1.00
R1294:Vmn1r25 UTSW 6 57978479 missense possibly damaging 0.55
R1562:Vmn1r25 UTSW 6 57978801 missense probably benign 0.03
R1661:Vmn1r25 UTSW 6 57978461 missense probably damaging 1.00
R1665:Vmn1r25 UTSW 6 57978461 missense probably damaging 1.00
R1879:Vmn1r25 UTSW 6 57978927 missense possibly damaging 0.50
R2221:Vmn1r25 UTSW 6 57979238 missense probably damaging 1.00
R2223:Vmn1r25 UTSW 6 57979238 missense probably damaging 1.00
R2374:Vmn1r25 UTSW 6 57978558 missense probably benign 0.10
R4073:Vmn1r25 UTSW 6 57978587 missense possibly damaging 0.94
R4398:Vmn1r25 UTSW 6 57978827 missense probably damaging 1.00
R4590:Vmn1r25 UTSW 6 57978495 missense probably benign 0.02
R4779:Vmn1r25 UTSW 6 57979026 missense probably damaging 0.98
R5397:Vmn1r25 UTSW 6 57979075 nonsense probably null
R6113:Vmn1r25 UTSW 6 57978572 missense probably benign 0.00
R6858:Vmn1r25 UTSW 6 57979011 missense probably benign 0.22
R7407:Vmn1r25 UTSW 6 57979059 missense possibly damaging 0.76
R7748:Vmn1r25 UTSW 6 57978564 missense probably damaging 1.00
R8001:Vmn1r25 UTSW 6 57979080 nonsense probably null
Predicted Primers PCR Primer

Sequencing Primer
(F):5'- tcatcagacacaccagaagag -3'
Posted On2013-04-16