Incidental Mutation 'R2393:Rho'
ID247858
Institutional Source Beutler Lab
Gene Symbol Rho
Ensembl Gene ENSMUSG00000030324
Gene Namerhodopsin
SynonymsNoerg1, Ops, RP4, Long Wavelength Sensitive opsin, opsin 2, L opsin, LWS opsin, Red Opsin, Opn2, Rod Opsin
MMRRC Submission 040361-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.104) question?
Stock #R2393 (G1)
Quality Score225
Status Validated
Chromosome6
Chromosomal Location115931748-115940036 bp(+) (GRCm38)
Type of Mutationsplice site
DNA Base Change (assembly) T to C at 115935391 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000144768 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000032471] [ENSMUST00000203877] [ENSMUST00000204493] [ENSMUST00000204711]
Predicted Effect probably benign
Transcript: ENSMUST00000032471
SMART Domains Protein: ENSMUSP00000032471
Gene: ENSMUSG00000030324

DomainStartEndE-ValueType
Pfam:Rhodopsin_N 2 37 1e-23 PFAM
Pfam:7TM_GPCR_Srv 40 323 1.2e-12 PFAM
Pfam:7TM_GPCR_Srw 42 324 7.9e-12 PFAM
Pfam:7TM_GPCR_Srsx 48 321 4.9e-11 PFAM
Pfam:7tm_1 54 306 5.1e-49 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000203284
Predicted Effect noncoding transcript
Transcript: ENSMUST00000203323
Predicted Effect noncoding transcript
Transcript: ENSMUST00000203531
Predicted Effect probably benign
Transcript: ENSMUST00000203877
SMART Domains Protein: ENSMUSP00000144952
Gene: ENSMUSG00000030324

DomainStartEndE-ValueType
Pfam:7tm_1 6 147 1.6e-17 PFAM
Pfam:7TM_GPCR_Srw 19 165 1.2e-8 PFAM
Pfam:7TM_GPCR_Srsx 25 162 1.2e-4 PFAM
Pfam:7TM_GPCR_Srv 29 164 7.3e-7 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000203894
Predicted Effect probably benign
Transcript: ENSMUST00000204493
SMART Domains Protein: ENSMUSP00000145464
Gene: ENSMUSG00000030324

DomainStartEndE-ValueType
low complexity region 20 41 N/A INTRINSIC
low complexity region 48 54 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000204711
SMART Domains Protein: ENSMUSP00000144768
Gene: ENSMUSG00000030324

DomainStartEndE-ValueType
Pfam:7tm_1 1 164 4.1e-24 PFAM
Pfam:7TM_GPCR_Srw 11 182 5.4e-9 PFAM
Pfam:7TM_GPCR_Srv 13 181 1.6e-7 PFAM
Meta Mutation Damage Score 0.0898 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.5%
  • 10x: 97.1%
  • 20x: 94.7%
Validation Efficiency 100% (54/54)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Retinitis pigmentosa is an inherited progressive disease which is a major cause of blindness in western communities. It can be inherited as an autosomal dominant, autosomal recessive, or X-linked recessive disorder. In the autosomal dominant form,which comprises about 25% of total cases, approximately 30% of families have mutations in the gene encoding the rod photoreceptor-specific protein rhodopsin. This is the transmembrane protein which, when photoexcited, initiates the visual transduction cascade. Defects in this gene are also one of the causes of congenital stationary night blindness. [provided by RefSeq, Jul 2008]
PHENOTYPE: Targeted null homozygotes fail to develop retinal rod outer segments and lose their photoreceptors while heterozygotes exhibit some disorganization of their photoreceptors and a shortening of the outer segments with age. Some point mutants have only light-induced photoreceptor degeneration. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 55 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca13 T A 11: 9,275,057 L512* probably null Het
Adam4 A T 12: 81,420,711 F379I probably benign Het
Ano6 C G 15: 95,966,025 probably benign Het
Apc2 A G 10: 80,313,069 E1319G possibly damaging Het
Arfgef3 A G 10: 18,597,787 V1588A possibly damaging Het
Arl8a T A 1: 135,152,866 V93E probably damaging Het
Arsi G A 18: 60,916,651 G202E probably benign Het
Cd200r2 T A 16: 44,909,267 I95N probably damaging Het
Cd209d A G 8: 3,878,436 probably null Het
Cep290 A G 10: 100,561,238 probably null Het
Chd2 G T 7: 73,507,883 D171E possibly damaging Het
Chrna7 G A 7: 63,099,246 A496V probably damaging Het
Col9a2 C G 4: 121,054,258 R599G probably damaging Het
Colgalt1 C G 8: 71,623,741 T612S probably benign Het
Copg2 T C 6: 30,810,958 K602E probably benign Het
Crtc1 T A 8: 70,388,158 T473S probably benign Het
Ctbp2 A T 7: 133,023,561 probably null Het
Edem1 T G 6: 108,852,543 M541R probably damaging Het
Ehmt1 A C 2: 24,806,217 V953G probably damaging Het
Fabp3 C T 4: 130,312,387 T57I probably benign Het
Fgfr2 T C 7: 130,227,238 probably null Het
Focad A G 4: 88,121,330 D10G probably damaging Het
Gm5901 G T 7: 105,377,789 V255F possibly damaging Het
Hsp90aa1 T C 12: 110,693,406 N416S probably damaging Het
Hspb1 T C 5: 135,889,096 F142L probably benign Het
Il17re C T 6: 113,462,353 H75Y possibly damaging Het
Kctd3 A G 1: 188,981,371 I389T probably damaging Het
Lhx6 T C 2: 36,091,390 D63G probably benign Het
Mepe A G 5: 104,337,461 T156A possibly damaging Het
Met A G 6: 17,534,198 Y680C probably damaging Het
Mrgpra3 T C 7: 47,589,617 Y187C possibly damaging Het
Mst1 T G 9: 108,082,952 probably null Het
Myh13 T A 11: 67,340,358 S394T possibly damaging Het
Nbeal1 T A 1: 60,251,370 V1042E probably damaging Het
Ndrg4 T A 8: 95,706,211 Y15* probably null Het
Neurl4 G A 11: 69,907,074 R720H probably damaging Het
Nfkbia A G 12: 55,490,670 probably benign Het
Nwd1 T A 8: 72,662,427 M202K probably benign Het
Olfr332 T A 11: 58,490,720 I12F probably benign Het
Olfr963 G T 9: 39,669,273 C72F possibly damaging Het
Pate2 T C 9: 35,669,740 probably benign Het
Pibf1 A G 14: 99,242,932 T715A probably benign Het
Pitpnm1 T C 19: 4,110,935 L858P probably benign Het
Pla2g3 A C 11: 3,493,115 S483R probably benign Het
Rad51ap2 T A 12: 11,457,797 D573E probably damaging Het
Rpl39l A T 16: 10,174,464 *52L probably null Het
Slco1a5 T A 6: 142,248,775 R381W possibly damaging Het
Spns3 T A 11: 72,550,233 probably benign Het
Srgap2 A G 1: 131,332,134 S493P probably benign Het
Tecpr2 T C 12: 110,926,402 S293P probably damaging Het
Tsta3 G T 15: 75,926,351 L191I probably damaging Het
Ttn C T 2: 76,752,867 V20815M probably benign Het
Ushbp1 T C 8: 71,394,488 I167V probably benign Het
Wdr81 C T 11: 75,449,405 A1296T probably damaging Het
Zmym2 A G 14: 56,920,723 Y573C probably benign Het
Other mutations in Rho
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02432:Rho APN 6 115932185 missense probably damaging 0.99
IGL02480:Rho APN 6 115935544 missense probably benign 0.20
IGL02625:Rho APN 6 115935197 missense possibly damaging 0.95
bemr3 UTSW 6 115935131 missense probably damaging 1.00
R0165:Rho UTSW 6 115932227 missense probably damaging 1.00
R1167:Rho UTSW 6 115935423 missense probably damaging 0.98
R1169:Rho UTSW 6 115932238 missense probably damaging 1.00
R1312:Rho UTSW 6 115935605 missense probably damaging 1.00
R3895:Rho UTSW 6 115933902 missense probably damaging 1.00
R4414:Rho UTSW 6 115935230 missense probably benign
R4416:Rho UTSW 6 115935230 missense probably benign
R5753:Rho UTSW 6 115935487 missense probably damaging 1.00
R6483:Rho UTSW 6 115932257 missense possibly damaging 0.78
R6552:Rho UTSW 6 115931748 splice site probably null
R6719:Rho UTSW 6 115933893 missense possibly damaging 0.58
R7030:Rho UTSW 6 115935543 missense possibly damaging 0.93
R7354:Rho UTSW 6 115935503 nonsense probably null
R7566:Rho UTSW 6 115932174 missense probably damaging 1.00
R7674:Rho UTSW 6 115932333 missense probably damaging 1.00
R7699:Rho UTSW 6 115935239 missense probably damaging 0.98
R7700:Rho UTSW 6 115935239 missense probably damaging 0.98
Predicted Primers PCR Primer
(F):5'- ACATGTTCGTGGTCCACTTC -3'
(R):5'- CCGGGTTATAGATGGAAGAGCTC -3'

Sequencing Primer
(F):5'- GTGGTCCACTTCACCATTCCTATG -3'
(R):5'- CTCTTAGCAAAGAAAGCTGGC -3'
Posted On2014-11-11