Incidental Mutation 'R2393:Olfr332'
ID247880
Institutional Source Beutler Lab
Gene Symbol Olfr332
Ensembl Gene ENSMUSG00000050813
Gene Nameolfactory receptor 332
SynonymsGA_x6K02T2NKPP-926908-927915, MOR284-2
MMRRC Submission 040361-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.055) question?
Stock #R2393 (G1)
Quality Score225
Status Validated
Chromosome11
Chromosomal Location58487950-58492555 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 58490720 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Phenylalanine at position 12 (I12F)
Ref Sequence ENSEMBL: ENSMUSP00000136008 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000180165] [ENSMUST00000203744]
Predicted Effect
Predicted Effect probably benign
Transcript: ENSMUST00000180165
AA Change: I12F

PolyPhen 2 Score 0.200 (Sensitivity: 0.92; Specificity: 0.88)
SMART Domains Protein: ENSMUSP00000136008
Gene: ENSMUSG00000050813
AA Change: I12F

DomainStartEndE-ValueType
Pfam:7tm_1 40 289 6.8e-33 PFAM
Pfam:7tm_4 138 282 4.1e-43 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000203744
Meta Mutation Damage Score 0.216 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.5%
  • 10x: 97.1%
  • 20x: 94.7%
Validation Efficiency 100% (54/54)
MGI Phenotype FUNCTION: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 55 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca13 T A 11: 9,275,057 L512* probably null Het
Adam4 A T 12: 81,420,711 F379I probably benign Het
Ano6 C G 15: 95,966,025 probably benign Het
Apc2 A G 10: 80,313,069 E1319G possibly damaging Het
Arfgef3 A G 10: 18,597,787 V1588A possibly damaging Het
Arl8a T A 1: 135,152,866 V93E probably damaging Het
Arsi G A 18: 60,916,651 G202E probably benign Het
Cd200r2 T A 16: 44,909,267 I95N probably damaging Het
Cd209d A G 8: 3,878,436 probably null Het
Cep290 A G 10: 100,561,238 probably null Het
Chd2 G T 7: 73,507,883 D171E possibly damaging Het
Chrna7 G A 7: 63,099,246 A496V probably damaging Het
Col9a2 C G 4: 121,054,258 R599G probably damaging Het
Colgalt1 C G 8: 71,623,741 T612S probably benign Het
Copg2 T C 6: 30,810,958 K602E probably benign Het
Crtc1 T A 8: 70,388,158 T473S probably benign Het
Ctbp2 A T 7: 133,023,561 probably null Het
Edem1 T G 6: 108,852,543 M541R probably damaging Het
Ehmt1 A C 2: 24,806,217 V953G probably damaging Het
Fabp3 C T 4: 130,312,387 T57I probably benign Het
Fgfr2 T C 7: 130,227,238 probably null Het
Focad A G 4: 88,121,330 D10G probably damaging Het
Gm5901 G T 7: 105,377,789 V255F possibly damaging Het
Hsp90aa1 T C 12: 110,693,406 N416S probably damaging Het
Hspb1 T C 5: 135,889,096 F142L probably benign Het
Il17re C T 6: 113,462,353 H75Y possibly damaging Het
Kctd3 A G 1: 188,981,371 I389T probably damaging Het
Lhx6 T C 2: 36,091,390 D63G probably benign Het
Mepe A G 5: 104,337,461 T156A possibly damaging Het
Met A G 6: 17,534,198 Y680C probably damaging Het
Mrgpra3 T C 7: 47,589,617 Y187C possibly damaging Het
Mst1 T G 9: 108,082,952 probably null Het
Myh13 T A 11: 67,340,358 S394T possibly damaging Het
Nbeal1 T A 1: 60,251,370 V1042E probably damaging Het
Ndrg4 T A 8: 95,706,211 Y15* probably null Het
Neurl4 G A 11: 69,907,074 R720H probably damaging Het
Nfkbia A G 12: 55,490,670 probably benign Het
Nwd1 T A 8: 72,662,427 M202K probably benign Het
Olfr963 G T 9: 39,669,273 C72F possibly damaging Het
Pate2 T C 9: 35,669,740 probably benign Het
Pibf1 A G 14: 99,242,932 T715A probably benign Het
Pitpnm1 T C 19: 4,110,935 L858P probably benign Het
Pla2g3 A C 11: 3,493,115 S483R probably benign Het
Rad51ap2 T A 12: 11,457,797 D573E probably damaging Het
Rho T C 6: 115,935,391 probably benign Het
Rpl39l A T 16: 10,174,464 *52L probably null Het
Slco1a5 T A 6: 142,248,775 R381W possibly damaging Het
Spns3 T A 11: 72,550,233 probably benign Het
Srgap2 A G 1: 131,332,134 S493P probably benign Het
Tecpr2 T C 12: 110,926,402 S293P probably damaging Het
Tsta3 G T 15: 75,926,351 L191I probably damaging Het
Ttn C T 2: 76,752,867 V20815M probably benign Het
Ushbp1 T C 8: 71,394,488 I167V probably benign Het
Wdr81 C T 11: 75,449,405 A1296T probably damaging Het
Zmym2 A G 14: 56,920,723 Y573C probably benign Het
Other mutations in Olfr332
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02510:Olfr332 APN 11 58490539 missense probably damaging 1.00
R1671:Olfr332 UTSW 11 58490609 missense possibly damaging 0.63
R2193:Olfr332 UTSW 11 58489906 missense probably damaging 0.97
R4713:Olfr332 UTSW 11 58490087 missense probably benign 0.01
R5328:Olfr332 UTSW 11 58490429 missense possibly damaging 0.91
R5636:Olfr332 UTSW 11 58490051 missense probably damaging 1.00
R6092:Olfr332 UTSW 11 58490074 missense probably damaging 1.00
R7011:Olfr332 UTSW 11 58490144 missense possibly damaging 0.69
R7172:Olfr332 UTSW 11 58489745 missense unknown
R7427:Olfr332 UTSW 11 58489780 missense probably benign
Predicted Primers PCR Primer
(F):5'- CCGGTGAAGTAGTTGATGGC -3'
(R):5'- GTGGAAATCTGCCTCTGAGAG -3'

Sequencing Primer
(F):5'- CACTGTGCAGGAGATATAAGCC -3'
(R):5'- GAAATCTGCCTCTGAGAGTTCCAG -3'
Posted On2014-11-11