Incidental Mutation 'R2393:Myh13'
ID247881
Institutional Source Beutler Lab
Gene Symbol Myh13
Ensembl Gene ENSMUSG00000060180
Gene Namemyosin, heavy polypeptide 13, skeletal muscle
SynonymsEO Myosin, extraocular myosin, MyHC-eo
MMRRC Submission 040361-MU
Accession Numbers

Genbank: NM_001081250; MGI: 1339967

Is this an essential gene? Probably non essential (E-score: 0.188) question?
Stock #R2393 (G1)
Quality Score225
Status Validated
Chromosome11
Chromosomal Location67321658-67371586 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 67340358 bp
ZygosityHeterozygous
Amino Acid Change Serine to Threonine at position 394 (S394T)
Ref Sequence ENSEMBL: ENSMUSP00000137731 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000081911] [ENSMUST00000108684] [ENSMUST00000180845]
Predicted Effect possibly damaging
Transcript: ENSMUST00000081911
AA Change: S394T

PolyPhen 2 Score 0.927 (Sensitivity: 0.81; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000080584
Gene: ENSMUSG00000060180
AA Change: S394T

DomainStartEndE-ValueType
Pfam:Myosin_N 35 74 8e-13 PFAM
MYSc 80 783 N/A SMART
IQ 784 806 4.6e-1 SMART
Pfam:Myosin_tail_1 847 1928 4.6e-159 PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000108684
AA Change: S394T

PolyPhen 2 Score 0.927 (Sensitivity: 0.81; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000104324
Gene: ENSMUSG00000060180
AA Change: S394T

DomainStartEndE-ValueType
Pfam:Myosin_N 35 76 2.8e-14 PFAM
MYSc 80 783 N/A SMART
IQ 784 806 4.6e-1 SMART
low complexity region 847 858 N/A INTRINSIC
low complexity region 925 940 N/A INTRINSIC
Pfam:Myosin_tail_1 1072 1930 N/A PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000180845
AA Change: S394T

PolyPhen 2 Score 0.927 (Sensitivity: 0.81; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000137731
Gene: ENSMUSG00000060180
AA Change: S394T

DomainStartEndE-ValueType
Pfam:Myosin_N 35 76 2.8e-14 PFAM
MYSc 80 783 N/A SMART
IQ 784 806 4.6e-1 SMART
low complexity region 847 858 N/A INTRINSIC
low complexity region 925 940 N/A INTRINSIC
Pfam:Myosin_tail_1 1072 1930 N/A PFAM
Meta Mutation Damage Score 0.0869 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.5%
  • 10x: 97.1%
  • 20x: 94.7%
Validation Efficiency 100% (54/54)
Allele List at MGI

All alleles(4) : Gene trapped(4)

Other mutations in this stock
Total: 55 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca13 T A 11: 9,275,057 L512* probably null Het
Adam4 A T 12: 81,420,711 F379I probably benign Het
Ano6 C G 15: 95,966,025 probably benign Het
Apc2 A G 10: 80,313,069 E1319G possibly damaging Het
Arfgef3 A G 10: 18,597,787 V1588A possibly damaging Het
Arl8a T A 1: 135,152,866 V93E probably damaging Het
Arsi G A 18: 60,916,651 G202E probably benign Het
Cd200r2 T A 16: 44,909,267 I95N probably damaging Het
Cd209d A G 8: 3,878,436 probably null Het
Cep290 A G 10: 100,561,238 probably null Het
Chd2 G T 7: 73,507,883 D171E possibly damaging Het
Chrna7 G A 7: 63,099,246 A496V probably damaging Het
Col9a2 C G 4: 121,054,258 R599G probably damaging Het
Colgalt1 C G 8: 71,623,741 T612S probably benign Het
Copg2 T C 6: 30,810,958 K602E probably benign Het
Crtc1 T A 8: 70,388,158 T473S probably benign Het
Ctbp2 A T 7: 133,023,561 probably null Het
Edem1 T G 6: 108,852,543 M541R probably damaging Het
Ehmt1 A C 2: 24,806,217 V953G probably damaging Het
Fabp3 C T 4: 130,312,387 T57I probably benign Het
Fgfr2 T C 7: 130,227,238 probably null Het
Focad A G 4: 88,121,330 D10G probably damaging Het
Gm5901 G T 7: 105,377,789 V255F possibly damaging Het
Hsp90aa1 T C 12: 110,693,406 N416S probably damaging Het
Hspb1 T C 5: 135,889,096 F142L probably benign Het
Il17re C T 6: 113,462,353 H75Y possibly damaging Het
Kctd3 A G 1: 188,981,371 I389T probably damaging Het
Lhx6 T C 2: 36,091,390 D63G probably benign Het
Mepe A G 5: 104,337,461 T156A possibly damaging Het
Met A G 6: 17,534,198 Y680C probably damaging Het
Mrgpra3 T C 7: 47,589,617 Y187C possibly damaging Het
Mst1 T G 9: 108,082,952 probably null Het
Nbeal1 T A 1: 60,251,370 V1042E probably damaging Het
Ndrg4 T A 8: 95,706,211 Y15* probably null Het
Neurl4 G A 11: 69,907,074 R720H probably damaging Het
Nfkbia A G 12: 55,490,670 probably benign Het
Nwd1 T A 8: 72,662,427 M202K probably benign Het
Olfr332 T A 11: 58,490,720 I12F probably benign Het
Olfr963 G T 9: 39,669,273 C72F possibly damaging Het
Pate2 T C 9: 35,669,740 probably benign Het
Pibf1 A G 14: 99,242,932 T715A probably benign Het
Pitpnm1 T C 19: 4,110,935 L858P probably benign Het
Pla2g3 A C 11: 3,493,115 S483R probably benign Het
Rad51ap2 T A 12: 11,457,797 D573E probably damaging Het
Rho T C 6: 115,935,391 probably benign Het
Rpl39l A T 16: 10,174,464 *52L probably null Het
Slco1a5 T A 6: 142,248,775 R381W possibly damaging Het
Spns3 T A 11: 72,550,233 probably benign Het
Srgap2 A G 1: 131,332,134 S493P probably benign Het
Tecpr2 T C 12: 110,926,402 S293P probably damaging Het
Tsta3 G T 15: 75,926,351 L191I probably damaging Het
Ttn C T 2: 76,752,867 V20815M probably benign Het
Ushbp1 T C 8: 71,394,488 I167V probably benign Het
Wdr81 C T 11: 75,449,405 A1296T probably damaging Het
Zmym2 A G 14: 56,920,723 Y573C probably benign Het
Other mutations in Myh13
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00497:Myh13 APN 11 67342488 missense probably damaging 1.00
IGL00808:Myh13 APN 11 67335004 critical splice donor site probably null
IGL00822:Myh13 APN 11 67361328 missense probably damaging 0.98
IGL00823:Myh13 APN 11 67355947 missense probably benign 0.00
IGL00945:Myh13 APN 11 67348006 missense probably null 1.00
IGL01414:Myh13 APN 11 67342472 missense probably benign 0.02
IGL01482:Myh13 APN 11 67352068 missense probably benign
IGL01523:Myh13 APN 11 67347943 missense possibly damaging 0.73
IGL01723:Myh13 APN 11 67369219 unclassified probably benign
IGL01997:Myh13 APN 11 67367166 missense probably benign 0.14
IGL02369:Myh13 APN 11 67360274 unclassified probably benign
IGL02478:Myh13 APN 11 67369378 missense probably benign
IGL02663:Myh13 APN 11 67354927 nonsense probably null
IGL02851:Myh13 APN 11 67348916 missense possibly damaging 0.92
IGL02863:Myh13 APN 11 67332541 missense probably damaging 1.00
IGL02929:Myh13 APN 11 67367165 missense probably damaging 1.00
IGL02979:Myh13 APN 11 67334962 missense possibly damaging 0.72
IGL03065:Myh13 APN 11 67344853 missense probably damaging 0.99
IGL03214:Myh13 APN 11 67353585 missense possibly damaging 0.79
IGL03223:Myh13 APN 11 67350242 missense probably benign 0.39
IGL03231:Myh13 APN 11 67351991 missense possibly damaging 0.94
IGL03407:Myh13 APN 11 67352152 missense probably damaging 1.00
3-1:Myh13 UTSW 11 67351951 splice site probably benign
P0042:Myh13 UTSW 11 67334991 missense probably benign 0.00
R0047:Myh13 UTSW 11 67367237 missense probably benign 0.00
R0047:Myh13 UTSW 11 67367237 missense probably benign 0.00
R0379:Myh13 UTSW 11 67369295 unclassified probably benign
R0496:Myh13 UTSW 11 67348815 missense probably damaging 1.00
R0584:Myh13 UTSW 11 67360374 nonsense probably null
R0595:Myh13 UTSW 11 67344846 missense probably benign 0.03
R0621:Myh13 UTSW 11 67341232 missense probably damaging 0.98
R0834:Myh13 UTSW 11 67349610 missense possibly damaging 0.88
R0893:Myh13 UTSW 11 67334601 missense probably damaging 1.00
R0964:Myh13 UTSW 11 67345002 missense probably benign 0.02
R0973:Myh13 UTSW 11 67332520 missense probably damaging 1.00
R0973:Myh13 UTSW 11 67332520 missense probably damaging 1.00
R0974:Myh13 UTSW 11 67332520 missense probably damaging 1.00
R1028:Myh13 UTSW 11 67356181 missense possibly damaging 0.71
R1112:Myh13 UTSW 11 67354750 missense probably damaging 1.00
R1283:Myh13 UTSW 11 67370921 missense probably damaging 1.00
R1288:Myh13 UTSW 11 67353718 missense probably benign 0.00
R1386:Myh13 UTSW 11 67370950 missense possibly damaging 0.79
R1457:Myh13 UTSW 11 67331046 missense probably damaging 0.97
R1503:Myh13 UTSW 11 67353674 missense probably benign 0.43
R1574:Myh13 UTSW 11 67362581 unclassified probably benign
R1673:Myh13 UTSW 11 67352119 missense possibly damaging 0.79
R1693:Myh13 UTSW 11 67341484 missense possibly damaging 0.95
R1763:Myh13 UTSW 11 67334576 missense probably benign
R2029:Myh13 UTSW 11 67361289 missense probably benign 0.03
R2030:Myh13 UTSW 11 67350238 missense probably benign
R2247:Myh13 UTSW 11 67334558 missense probably damaging 0.96
R2395:Myh13 UTSW 11 67364922 missense probably benign 0.12
R2884:Myh13 UTSW 11 67337643 missense probably benign 0.27
R3696:Myh13 UTSW 11 67345044 missense possibly damaging 0.55
R3786:Myh13 UTSW 11 67327188 missense probably benign 0.01
R3875:Myh13 UTSW 11 67358194 missense probably benign 0.26
R3918:Myh13 UTSW 11 67329238 missense probably benign 0.00
R4061:Myh13 UTSW 11 67330889 missense possibly damaging 0.71
R4160:Myh13 UTSW 11 67364810 intron probably benign
R4183:Myh13 UTSW 11 67349610 missense possibly damaging 0.88
R4392:Myh13 UTSW 11 67344881 splice site probably null
R4639:Myh13 UTSW 11 67341551 missense possibly damaging 0.91
R4670:Myh13 UTSW 11 67364738 nonsense probably null
R4783:Myh13 UTSW 11 67341270 missense probably damaging 1.00
R4877:Myh13 UTSW 11 67337651 missense probably damaging 0.99
R5250:Myh13 UTSW 11 67327259 nonsense probably null
R5278:Myh13 UTSW 11 67334564 missense probably benign 0.00
R5371:Myh13 UTSW 11 67344790 splice site probably null
R5479:Myh13 UTSW 11 67348822 missense probably damaging 0.97
R5510:Myh13 UTSW 11 67337723 missense probably benign 0.05
R5690:Myh13 UTSW 11 67329275 missense probably damaging 1.00
R5797:Myh13 UTSW 11 67335002 missense possibly damaging 0.66
R5823:Myh13 UTSW 11 67360468 missense probably damaging 1.00
R5877:Myh13 UTSW 11 67353658 missense possibly damaging 0.78
R6041:Myh13 UTSW 11 67364730 missense probably damaging 1.00
R6175:Myh13 UTSW 11 67354762 missense probably benign 0.00
R6244:Myh13 UTSW 11 67362501 missense probably benign 0.00
R6454:Myh13 UTSW 11 67350365 missense probably benign 0.03
R6617:Myh13 UTSW 11 67361400 missense probably benign 0.00
R6707:Myh13 UTSW 11 67350260 missense probably damaging 1.00
R6747:Myh13 UTSW 11 67350419 missense probably damaging 0.99
R6823:Myh13 UTSW 11 67356158 missense probably benign
R6911:Myh13 UTSW 11 67354927 nonsense probably null
R6997:Myh13 UTSW 11 67327154 nonsense probably null
R7033:Myh13 UTSW 11 67369316 missense possibly damaging 0.92
R7145:Myh13 UTSW 11 67354740 missense probably benign 0.08
R7232:Myh13 UTSW 11 67348846 missense probably damaging 1.00
R7428:Myh13 UTSW 11 67332564 missense probably damaging 1.00
R7448:Myh13 UTSW 11 67364460 critical splice acceptor site probably null
R7474:Myh13 UTSW 11 67327164 missense possibly damaging 0.93
R7474:Myh13 UTSW 11 67367711 missense
R7766:Myh13 UTSW 11 67358329 missense probably benign 0.37
R7809:Myh13 UTSW 11 67350341 missense probably benign 0.14
R7813:Myh13 UTSW 11 67327230 missense probably benign 0.27
R7953:Myh13 UTSW 11 67340380 missense probably damaging 1.00
R8085:Myh13 UTSW 11 67334787 missense probably benign 0.00
R8397:Myh13 UTSW 11 67350287 missense possibly damaging 0.62
R8434:Myh13 UTSW 11 67363185 critical splice acceptor site probably null
R8490:Myh13 UTSW 11 67364525 missense probably damaging 0.98
R8676:Myh13 UTSW 11 67342485 missense probably damaging 1.00
R8681:Myh13 UTSW 11 67352134 missense possibly damaging 0.49
R8777:Myh13 UTSW 11 67361335 missense possibly damaging 0.92
R8777-TAIL:Myh13 UTSW 11 67361335 missense possibly damaging 0.92
Z1176:Myh13 UTSW 11 67329295 missense possibly damaging 0.93
Z1177:Myh13 UTSW 11 67350452 missense possibly damaging 0.55
Z1177:Myh13 UTSW 11 67364591 missense possibly damaging 0.93
Predicted Primers PCR Primer
(F):5'- CCCCTGTTTGATGGGATGAG -3'
(R):5'- ATTTCCACCTTGATGCTGAAGC -3'

Sequencing Primer
(F):5'- GAGGTTTTACAGACAAGTCCATGCC -3'
(R):5'- GCTGAAGCAGTTTCATACAACTTTC -3'
Posted On2014-11-11