Incidental Mutation 'R2393:Rad51ap2'
ID 247885
Institutional Source Beutler Lab
Gene Symbol Rad51ap2
Ensembl Gene ENSMUSG00000086022
Gene Name RAD51 associated protein 2
Synonyms
MMRRC Submission 040361-MU
Accession Numbers
Essential gene? Non essential (E-score: 0.000) question?
Stock # R2393 (G1)
Quality Score 225
Status Validated
Chromosome 12
Chromosomal Location 11506080-11512929 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) T to A at 11507798 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Aspartic acid to Glutamic Acid at position 573 (D573E)
Ref Sequence ENSEMBL: ENSMUSP00000128854 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000124065]
AlphaFold G3UW63
Predicted Effect probably damaging
Transcript: ENSMUST00000124065
AA Change: D573E

PolyPhen 2 Score 0.975 (Sensitivity: 0.76; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000128854
Gene: ENSMUSG00000086022
AA Change: D573E

DomainStartEndE-ValueType
low complexity region 17 32 N/A INTRINSIC
low complexity region 428 438 N/A INTRINSIC
low complexity region 702 713 N/A INTRINSIC
Pfam:RAD51_interact 937 975 1.3e-20 PFAM
Meta Mutation Damage Score 0.6467 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.5%
  • 10x: 97.1%
  • 20x: 94.7%
Validation Efficiency 100% (54/54)
Allele List at MGI
Other mutations in this stock
Total: 55 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca13 T A 11: 9,225,057 (GRCm39) L512* probably null Het
Adam4 A T 12: 81,467,485 (GRCm39) F379I probably benign Het
Ano6 C G 15: 95,863,906 (GRCm39) probably benign Het
Apc2 A G 10: 80,148,903 (GRCm39) E1319G possibly damaging Het
Arfgef3 A G 10: 18,473,535 (GRCm39) V1588A possibly damaging Het
Arl8a T A 1: 135,080,604 (GRCm39) V93E probably damaging Het
Arsi G A 18: 61,049,723 (GRCm39) G202E probably benign Het
Cd200r2 T A 16: 44,729,630 (GRCm39) I95N probably damaging Het
Cd209d A G 8: 3,928,436 (GRCm39) probably null Het
Cep290 A G 10: 100,397,100 (GRCm39) probably null Het
Chd2 G T 7: 73,157,631 (GRCm39) D171E possibly damaging Het
Chrna7 G A 7: 62,748,994 (GRCm39) A496V probably damaging Het
Col9a2 C G 4: 120,911,455 (GRCm39) R599G probably damaging Het
Colgalt1 C G 8: 72,076,385 (GRCm39) T612S probably benign Het
Copg2 T C 6: 30,787,893 (GRCm39) K602E probably benign Het
Crtc1 T A 8: 70,840,808 (GRCm39) T473S probably benign Het
Ctbp2 A T 7: 132,625,290 (GRCm39) probably null Het
Edem1 T G 6: 108,829,504 (GRCm39) M541R probably damaging Het
Ehmt1 A C 2: 24,696,229 (GRCm39) V953G probably damaging Het
Fabp3 C T 4: 130,206,180 (GRCm39) T57I probably benign Het
Fgfr2 T C 7: 129,828,968 (GRCm39) probably null Het
Focad A G 4: 88,039,567 (GRCm39) D10G probably damaging Het
Gfus G T 15: 75,798,200 (GRCm39) L191I probably damaging Het
Gm5901 G T 7: 105,026,996 (GRCm39) V255F possibly damaging Het
Hsp90aa1 T C 12: 110,659,840 (GRCm39) N416S probably damaging Het
Hspb1 T C 5: 135,917,950 (GRCm39) F142L probably benign Het
Il17re C T 6: 113,439,314 (GRCm39) H75Y possibly damaging Het
Kctd3 A G 1: 188,713,568 (GRCm39) I389T probably damaging Het
Lhx6 T C 2: 35,981,402 (GRCm39) D63G probably benign Het
Mepe A G 5: 104,485,327 (GRCm39) T156A possibly damaging Het
Met A G 6: 17,534,197 (GRCm39) Y680C probably damaging Het
Mrgpra3 T C 7: 47,239,365 (GRCm39) Y187C possibly damaging Het
Mst1 T G 9: 107,960,151 (GRCm39) probably null Het
Myh13 T A 11: 67,231,184 (GRCm39) S394T possibly damaging Het
Nbeal1 T A 1: 60,290,529 (GRCm39) V1042E probably damaging Het
Ndrg4 T A 8: 96,432,839 (GRCm39) Y15* probably null Het
Neurl4 G A 11: 69,797,900 (GRCm39) R720H probably damaging Het
Nfkbia A G 12: 55,537,455 (GRCm39) probably benign Het
Nwd1 T A 8: 73,389,055 (GRCm39) M202K probably benign Het
Or10d4 G T 9: 39,580,569 (GRCm39) C72F possibly damaging Het
Or2av9 T A 11: 58,381,546 (GRCm39) I12F probably benign Het
Pate2 T C 9: 35,581,036 (GRCm39) probably benign Het
Pibf1 A G 14: 99,480,368 (GRCm39) T715A probably benign Het
Pitpnm1 T C 19: 4,160,935 (GRCm39) L858P probably benign Het
Pla2g3 A C 11: 3,443,115 (GRCm39) S483R probably benign Het
Rho T C 6: 115,912,352 (GRCm39) probably benign Het
Rpl39l A T 16: 9,992,328 (GRCm39) *52L probably null Het
Slco1a5 T A 6: 142,194,501 (GRCm39) R381W possibly damaging Het
Spns3 T A 11: 72,441,059 (GRCm39) probably benign Het
Srgap2 A G 1: 131,259,872 (GRCm39) S493P probably benign Het
Tecpr2 T C 12: 110,892,836 (GRCm39) S293P probably damaging Het
Ttn C T 2: 76,583,211 (GRCm39) V20815M probably benign Het
Ushbp1 T C 8: 71,847,132 (GRCm39) I167V probably benign Het
Wdr81 C T 11: 75,340,231 (GRCm39) A1296T probably damaging Het
Zmym2 A G 14: 57,158,180 (GRCm39) Y573C probably benign Het
Other mutations in Rad51ap2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01879:Rad51ap2 APN 12 11,508,139 (GRCm39) missense probably benign 0.10
IGL01908:Rad51ap2 APN 12 11,508,592 (GRCm39) missense probably damaging 1.00
IGL02415:Rad51ap2 APN 12 11,506,930 (GRCm39) missense possibly damaging 0.91
IGL02731:Rad51ap2 APN 12 11,506,897 (GRCm39) missense probably damaging 0.99
IGL03407:Rad51ap2 APN 12 11,507,198 (GRCm39) missense possibly damaging 0.96
R0190:Rad51ap2 UTSW 12 11,508,540 (GRCm39) missense probably benign 0.01
R0281:Rad51ap2 UTSW 12 11,507,043 (GRCm39) missense possibly damaging 0.93
R0564:Rad51ap2 UTSW 12 11,507,897 (GRCm39) missense probably benign 0.20
R0674:Rad51ap2 UTSW 12 11,508,818 (GRCm39) critical splice donor site probably null
R0699:Rad51ap2 UTSW 12 11,507,601 (GRCm39) missense probably benign 0.03
R1033:Rad51ap2 UTSW 12 11,506,252 (GRCm39) missense probably damaging 0.98
R1255:Rad51ap2 UTSW 12 11,508,095 (GRCm39) missense possibly damaging 0.54
R1572:Rad51ap2 UTSW 12 11,507,113 (GRCm39) missense probably damaging 0.99
R1746:Rad51ap2 UTSW 12 11,507,776 (GRCm39) missense probably benign
R1882:Rad51ap2 UTSW 12 11,506,251 (GRCm39) missense possibly damaging 0.85
R2038:Rad51ap2 UTSW 12 11,507,025 (GRCm39) missense possibly damaging 0.73
R2151:Rad51ap2 UTSW 12 11,507,986 (GRCm39) missense probably benign 0.02
R2152:Rad51ap2 UTSW 12 11,507,986 (GRCm39) missense probably benign 0.02
R2154:Rad51ap2 UTSW 12 11,507,986 (GRCm39) missense probably benign 0.02
R2159:Rad51ap2 UTSW 12 11,507,752 (GRCm39) missense possibly damaging 0.87
R2321:Rad51ap2 UTSW 12 11,507,058 (GRCm39) missense probably damaging 1.00
R2355:Rad51ap2 UTSW 12 11,507,109 (GRCm39) missense probably benign
R2407:Rad51ap2 UTSW 12 11,508,502 (GRCm39) missense probably damaging 0.99
R2518:Rad51ap2 UTSW 12 11,507,068 (GRCm39) missense probably damaging 0.99
R2929:Rad51ap2 UTSW 12 11,507,185 (GRCm39) missense probably benign 0.07
R3085:Rad51ap2 UTSW 12 11,506,758 (GRCm39) missense possibly damaging 0.53
R4009:Rad51ap2 UTSW 12 11,507,052 (GRCm39) missense probably benign 0.33
R4108:Rad51ap2 UTSW 12 11,508,396 (GRCm39) missense probably damaging 1.00
R4282:Rad51ap2 UTSW 12 11,506,465 (GRCm39) missense probably benign 0.01
R4536:Rad51ap2 UTSW 12 11,507,850 (GRCm39) missense possibly damaging 0.90
R4594:Rad51ap2 UTSW 12 11,507,881 (GRCm39) missense probably benign 0.01
R4678:Rad51ap2 UTSW 12 11,506,552 (GRCm39) missense probably damaging 0.96
R4679:Rad51ap2 UTSW 12 11,506,552 (GRCm39) missense probably damaging 0.96
R4810:Rad51ap2 UTSW 12 11,507,406 (GRCm39) missense probably damaging 1.00
R5151:Rad51ap2 UTSW 12 11,507,516 (GRCm39) missense probably benign 0.09
R5421:Rad51ap2 UTSW 12 11,509,368 (GRCm39) nonsense probably null
R5517:Rad51ap2 UTSW 12 11,508,313 (GRCm39) missense probably benign 0.19
R5786:Rad51ap2 UTSW 12 11,506,921 (GRCm39) missense probably damaging 1.00
R5884:Rad51ap2 UTSW 12 11,507,534 (GRCm39) small deletion probably benign
R5932:Rad51ap2 UTSW 12 11,508,387 (GRCm39) missense probably damaging 1.00
R6022:Rad51ap2 UTSW 12 11,508,523 (GRCm39) missense probably damaging 1.00
R6064:Rad51ap2 UTSW 12 11,507,418 (GRCm39) missense possibly damaging 0.80
R6112:Rad51ap2 UTSW 12 11,507,290 (GRCm39) missense probably benign 0.01
R6235:Rad51ap2 UTSW 12 11,507,517 (GRCm39) missense possibly damaging 0.70
R6282:Rad51ap2 UTSW 12 11,507,560 (GRCm39) missense probably benign 0.12
R6488:Rad51ap2 UTSW 12 11,508,161 (GRCm39) missense possibly damaging 0.56
R6668:Rad51ap2 UTSW 12 11,507,647 (GRCm39) missense probably benign 0.17
R6759:Rad51ap2 UTSW 12 11,507,145 (GRCm39) missense possibly damaging 0.91
R7030:Rad51ap2 UTSW 12 11,507,432 (GRCm39) missense possibly damaging 0.93
R7080:Rad51ap2 UTSW 12 11,506,366 (GRCm39) missense probably benign
R7105:Rad51ap2 UTSW 12 11,508,278 (GRCm39) missense possibly damaging 0.84
R7269:Rad51ap2 UTSW 12 11,506,807 (GRCm39) missense possibly damaging 0.67
R7286:Rad51ap2 UTSW 12 11,507,692 (GRCm39) missense probably benign 0.19
R7305:Rad51ap2 UTSW 12 11,507,344 (GRCm39) missense possibly damaging 0.68
R7451:Rad51ap2 UTSW 12 11,507,982 (GRCm39) missense probably benign 0.05
R7632:Rad51ap2 UTSW 12 11,507,116 (GRCm39) missense possibly damaging 0.85
R7833:Rad51ap2 UTSW 12 11,506,656 (GRCm39) missense probably benign
R7839:Rad51ap2 UTSW 12 11,507,238 (GRCm39) missense possibly damaging 0.83
R7953:Rad51ap2 UTSW 12 11,512,593 (GRCm39) nonsense probably null
R8040:Rad51ap2 UTSW 12 11,508,792 (GRCm39) missense probably benign 0.03
R8879:Rad51ap2 UTSW 12 11,507,401 (GRCm39) missense possibly damaging 0.55
R8963:Rad51ap2 UTSW 12 11,506,255 (GRCm39) missense possibly damaging 0.91
R9010:Rad51ap2 UTSW 12 11,508,675 (GRCm39) missense probably benign 0.01
R9328:Rad51ap2 UTSW 12 11,507,772 (GRCm39) missense probably benign 0.03
R9691:Rad51ap2 UTSW 12 11,509,413 (GRCm39) missense possibly damaging 0.70
R9712:Rad51ap2 UTSW 12 11,507,593 (GRCm39) missense possibly damaging 0.95
RF023:Rad51ap2 UTSW 12 11,508,076 (GRCm39) missense possibly damaging 0.94
X0026:Rad51ap2 UTSW 12 11,508,097 (GRCm39) missense possibly damaging 0.93
Predicted Primers PCR Primer
(F):5'- GGAACATGTTCTTCAACGGG -3'
(R):5'- ACAATGTGCACAGTTGTCTAAC -3'

Sequencing Primer
(F):5'- GGAACATGTTCTTCAACGGGTTAAG -3'
(R):5'- GTGCACAGTTGTCTAACATTAAAGAC -3'
Posted On 2014-11-11