Incidental Mutation 'R2393:Nfkbia'
ID247886
Institutional Source Beutler Lab
Gene Symbol Nfkbia
Ensembl Gene ENSMUSG00000021025
Gene Namenuclear factor of kappa light polypeptide gene enhancer in B cells inhibitor, alpha
SynonymsI-kappaBalpha, I(Kappa)B(alpha), Nfkbi, IkappaBalpha
MMRRC Submission 040361-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R2393 (G1)
Quality Score225
Status Validated
Chromosome12
Chromosomal Location55489410-55492647 bp(-) (GRCm38)
Type of Mutationsplice site
DNA Base Change (assembly) A to G at 55490670 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000021413 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000021413]
Predicted Effect probably benign
Transcript: ENSMUST00000021413
SMART Domains Protein: ENSMUSP00000021413
Gene: ENSMUSG00000021025

DomainStartEndE-ValueType
ANK 73 103 1.39e3 SMART
ANK 110 139 5.93e-3 SMART
ANK 143 172 3.04e0 SMART
ANK 182 211 4.39e-6 SMART
ANK 216 245 9.41e-6 SMART
low complexity region 282 299 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000219869
Meta Mutation Damage Score 0.0898 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.5%
  • 10x: 97.1%
  • 20x: 94.7%
Validation Efficiency 100% (54/54)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the NF-kappa-B inhibitor family, which contain multiple ankrin repeat domains. The encoded protein interacts with REL dimers to inhibit NF-kappa-B/REL complexes which are involved in inflammatory responses. The encoded protein moves between the cytoplasm and the nucleus via a nuclear localization signal and CRM1-mediated nuclear export. Mutations in this gene have been found in ectodermal dysplasia anhidrotic with T-cell immunodeficiency autosomal dominant disease. [provided by RefSeq, Aug 2011]
PHENOTYPE: Mice homozygous for disruptions in this gene die at about 1 week of age experiencing abnormalities in the immune system. Mice homozygous for an allele disrupting the N-terminal nuclear export signal exhibit impaired B cell maturation, decreased CD4+ memory T cells, and decreased regulatory T cells. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 55 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca13 T A 11: 9,275,057 L512* probably null Het
Adam4 A T 12: 81,420,711 F379I probably benign Het
Ano6 C G 15: 95,966,025 probably benign Het
Apc2 A G 10: 80,313,069 E1319G possibly damaging Het
Arfgef3 A G 10: 18,597,787 V1588A possibly damaging Het
Arl8a T A 1: 135,152,866 V93E probably damaging Het
Arsi G A 18: 60,916,651 G202E probably benign Het
Cd200r2 T A 16: 44,909,267 I95N probably damaging Het
Cd209d A G 8: 3,878,436 probably null Het
Cep290 A G 10: 100,561,238 probably null Het
Chd2 G T 7: 73,507,883 D171E possibly damaging Het
Chrna7 G A 7: 63,099,246 A496V probably damaging Het
Col9a2 C G 4: 121,054,258 R599G probably damaging Het
Colgalt1 C G 8: 71,623,741 T612S probably benign Het
Copg2 T C 6: 30,810,958 K602E probably benign Het
Crtc1 T A 8: 70,388,158 T473S probably benign Het
Ctbp2 A T 7: 133,023,561 probably null Het
Edem1 T G 6: 108,852,543 M541R probably damaging Het
Ehmt1 A C 2: 24,806,217 V953G probably damaging Het
Fabp3 C T 4: 130,312,387 T57I probably benign Het
Fgfr2 T C 7: 130,227,238 probably null Het
Focad A G 4: 88,121,330 D10G probably damaging Het
Gm5901 G T 7: 105,377,789 V255F possibly damaging Het
Hsp90aa1 T C 12: 110,693,406 N416S probably damaging Het
Hspb1 T C 5: 135,889,096 F142L probably benign Het
Il17re C T 6: 113,462,353 H75Y possibly damaging Het
Kctd3 A G 1: 188,981,371 I389T probably damaging Het
Lhx6 T C 2: 36,091,390 D63G probably benign Het
Mepe A G 5: 104,337,461 T156A possibly damaging Het
Met A G 6: 17,534,198 Y680C probably damaging Het
Mrgpra3 T C 7: 47,589,617 Y187C possibly damaging Het
Mst1 T G 9: 108,082,952 probably null Het
Myh13 T A 11: 67,340,358 S394T possibly damaging Het
Nbeal1 T A 1: 60,251,370 V1042E probably damaging Het
Ndrg4 T A 8: 95,706,211 Y15* probably null Het
Neurl4 G A 11: 69,907,074 R720H probably damaging Het
Nwd1 T A 8: 72,662,427 M202K probably benign Het
Olfr332 T A 11: 58,490,720 I12F probably benign Het
Olfr963 G T 9: 39,669,273 C72F possibly damaging Het
Pate2 T C 9: 35,669,740 probably benign Het
Pibf1 A G 14: 99,242,932 T715A probably benign Het
Pitpnm1 T C 19: 4,110,935 L858P probably benign Het
Pla2g3 A C 11: 3,493,115 S483R probably benign Het
Rad51ap2 T A 12: 11,457,797 D573E probably damaging Het
Rho T C 6: 115,935,391 probably benign Het
Rpl39l A T 16: 10,174,464 *52L probably null Het
Slco1a5 T A 6: 142,248,775 R381W possibly damaging Het
Spns3 T A 11: 72,550,233 probably benign Het
Srgap2 A G 1: 131,332,134 S493P probably benign Het
Tecpr2 T C 12: 110,926,402 S293P probably damaging Het
Tsta3 G T 15: 75,926,351 L191I probably damaging Het
Ttn C T 2: 76,752,867 V20815M probably benign Het
Ushbp1 T C 8: 71,394,488 I167V probably benign Het
Wdr81 C T 11: 75,449,405 A1296T probably damaging Het
Zmym2 A G 14: 56,920,723 Y573C probably benign Het
Other mutations in Nfkbia
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01019:Nfkbia APN 12 55490542 missense probably damaging 1.00
IGL01517:Nfkbia APN 12 55490645 missense probably damaging 0.99
IGL02636:Nfkbia APN 12 55491173 missense possibly damaging 0.48
R0836:Nfkbia UTSW 12 55490776 missense probably damaging 1.00
R2031:Nfkbia UTSW 12 55491152 missense probably damaging 1.00
R5821:Nfkbia UTSW 12 55491220 missense probably damaging 1.00
R7568:Nfkbia UTSW 12 55491761 missense probably damaging 1.00
X0061:Nfkbia UTSW 12 55490587 missense possibly damaging 0.81
Predicted Primers PCR Primer
(F):5'- CTGCTGTATCCGGGTACTTG -3'
(R):5'- TTGTGTGAGGATTGAAACACG -3'

Sequencing Primer
(F):5'- ATCCGGGTACTTGGGCGG -3'
(R):5'- ACACGTGTCTGCACCTAGC -3'
Posted On2014-11-11